Incidental Mutation 'R6906:Mgam'
ID538775
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
Synonyms6030407P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40747919 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 443 (Y443C)
Ref Sequence ENSEMBL: ENSMUSP00000144680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
Predicted Effect probably benign
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202779
AA Change: Y562C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: Y562C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202966
AA Change: Y443C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: Y443C

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,568,842 F350L possibly damaging Het
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Gm8251 C T 1: 44,056,013 S1975N probably benign Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Prl8a2 T A 13: 27,348,917 N37K probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Rnf112 T C 11: 61,450,389 S457G probably null Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Srrm2 C T 17: 23,820,363 P2090S probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Vmn1r171 G A 7: 23,632,379 V10I probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 unclassified probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 intron probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 intron probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7942:Mgam UTSW 6 40740179 missense possibly damaging 0.75
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATCCTCTGGGGTTTTCC -3'
(R):5'- CTGCCTGCAATGCTGTAACAATTAG -3'

Sequencing Primer
(F):5'- GATCCTCTGGGGTTTTCCTTTTTCAG -3'
(R):5'- TGGAATCTAGGTACTAATCCCTTTTC -3'
Posted On2018-11-06