Incidental Mutation 'R6906:Rnf112'
ID538790
Institutional Source Beutler Lab
Gene Symbol Rnf112
Ensembl Gene ENSMUSG00000010086
Gene Namering finger protein 112
SynonymsZfp179, bfp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6906 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location61448442-61454131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61450389 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 457 (S457G)
Ref Sequence ENSEMBL: ENSMUSP00000059903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054927] [ENSMUST00000060255] [ENSMUST00000102661]
Predicted Effect probably null
Transcript: ENSMUST00000054927
AA Change: S432G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056464
Gene: ENSMUSG00000010086
AA Change: S432G

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 423 1.3e-21 PFAM
low complexity region 541 557 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060255
AA Change: S457G

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059903
Gene: ENSMUSG00000010086
AA Change: S457G

DomainStartEndE-ValueType
RING 80 120 3.78e-5 SMART
low complexity region 139 150 N/A INTRINSIC
Pfam:GBP 171 448 2.8e-21 PFAM
low complexity region 566 582 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102661
AA Change: S409G

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099722
Gene: ENSMUSG00000010086
AA Change: S409G

DomainStartEndE-ValueType
RING 57 97 1.7e-7 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:GBP 148 400 2.7e-19 PFAM
low complexity region 518 534 N/A INTRINSIC
transmembrane domain 547 569 N/A INTRINSIC
transmembrane domain 582 604 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced dendritic spines, functional synapses and paired pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,568,842 F350L possibly damaging Het
Ahnak2 T A 12: 112,785,313 T305S probably benign Het
Anp32a A G 9: 62,377,569 probably benign Het
Aplf A G 6: 87,630,086 S449P possibly damaging Het
Arl6ip4 A G 5: 124,116,551 R36G possibly damaging Het
Ascc1 G A 10: 60,004,852 D12N probably benign Het
Bin1 C A 18: 32,421,925 H243Q probably benign Het
Ccdc7a C A 8: 128,935,681 V547L unknown Het
Cntnap5c T A 17: 58,395,307 N1207K probably benign Het
Coro7 C A 16: 4,633,304 R507L probably benign Het
Crtap T A 9: 114,381,632 K291N probably benign Het
Csmd3 T C 15: 47,847,173 T1569A probably benign Het
Dmrta1 A G 4: 89,691,966 T388A probably benign Het
Ehd3 T C 17: 73,830,338 F501L probably damaging Het
Fam126a A T 5: 23,999,958 W12R probably damaging Het
Fam160a2 G A 7: 105,388,269 T369I probably damaging Het
Fbn2 A C 18: 58,071,819 L1184R possibly damaging Het
Gm8251 C T 1: 44,056,013 S1975N probably benign Het
Hsf1 T C 15: 76,477,719 probably null Het
Kansl1l T C 1: 66,723,278 H810R possibly damaging Het
Lrp5 A T 19: 3,622,638 I557N probably damaging Het
Lypd1 T C 1: 125,910,459 E41G probably damaging Het
Mgam A G 6: 40,747,919 Y443C probably damaging Het
Muc2 A G 7: 141,698,733 D871G probably damaging Het
Nup85 T A 11: 115,580,943 Y198N probably damaging Het
Obscn T A 11: 59,032,918 M6578L possibly damaging Het
Olfr1097 T C 2: 86,890,747 T143A probably benign Het
Osbpl5 G C 7: 143,694,328 Q667E probably damaging Het
Ovgp1 T A 3: 105,986,873 probably benign Het
Prl8a2 T A 13: 27,348,917 N37K probably benign Het
Ptprf A T 4: 118,269,277 I93N possibly damaging Het
Sema3e A G 5: 14,240,587 D562G probably damaging Het
Sesn3 A G 9: 14,325,641 M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shc3 T C 13: 51,466,559 T144A probably damaging Het
Sis A G 3: 72,919,485 L1287P probably damaging Het
Srrm2 C T 17: 23,820,363 P2090S probably damaging Het
Syne2 T G 12: 75,995,986 D3910E possibly damaging Het
Tcaim C T 9: 122,834,774 T443I probably benign Het
Tex19.1 T C 11: 121,147,122 V102A probably benign Het
Tpd52l1 T G 10: 31,332,954 T168P possibly damaging Het
Trdn G A 10: 33,233,948 C294Y probably benign Het
Trmt1l T C 1: 151,452,175 Y479H probably benign Het
Vmn1r171 G A 7: 23,632,379 V10I probably benign Het
Zbtb41 T A 1: 139,423,390 D80E possibly damaging Het
Zcchc4 A G 5: 52,823,634 K473E possibly damaging Het
Other mutations in Rnf112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Rnf112 APN 11 61452784 missense probably damaging 1.00
IGL01339:Rnf112 APN 11 61450477 missense probably benign 0.00
IGL01469:Rnf112 APN 11 61451341 missense possibly damaging 0.94
IGL02102:Rnf112 APN 11 61452015 missense probably benign 0.36
IGL02216:Rnf112 APN 11 61449978 missense probably damaging 1.00
IGL02431:Rnf112 APN 11 61450379 missense probably benign 0.17
IGL02638:Rnf112 APN 11 61449405 utr 3 prime probably benign
IGL02657:Rnf112 APN 11 61450252 splice site probably null
R0041:Rnf112 UTSW 11 61452355 missense probably damaging 1.00
R1514:Rnf112 UTSW 11 61450410 missense probably benign 0.01
R1991:Rnf112 UTSW 11 61452426 missense probably damaging 1.00
R2119:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R2216:Rnf112 UTSW 11 61452279 missense probably damaging 1.00
R2880:Rnf112 UTSW 11 61450467 missense possibly damaging 0.89
R3775:Rnf112 UTSW 11 61450185 splice site probably benign
R3904:Rnf112 UTSW 11 61450385 missense probably damaging 1.00
R4646:Rnf112 UTSW 11 61452110 missense probably damaging 0.99
R4710:Rnf112 UTSW 11 61449831 missense probably damaging 1.00
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4860:Rnf112 UTSW 11 61452744 missense possibly damaging 0.67
R4894:Rnf112 UTSW 11 61452662 missense probably damaging 1.00
R4930:Rnf112 UTSW 11 61453465 missense probably benign
R4967:Rnf112 UTSW 11 61452926 splice site probably benign
R4992:Rnf112 UTSW 11 61452711 missense possibly damaging 0.72
R5547:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R5874:Rnf112 UTSW 11 61449447 missense probably damaging 0.98
R5997:Rnf112 UTSW 11 61451022 missense possibly damaging 0.87
R6023:Rnf112 UTSW 11 61449729 missense probably damaging 1.00
R7194:Rnf112 UTSW 11 61450857 missense probably damaging 1.00
R7439:Rnf112 UTSW 11 61451028 missense possibly damaging 0.92
R7984:Rnf112 UTSW 11 61449480 missense possibly damaging 0.79
Z1177:Rnf112 UTSW 11 61449679 missense probably damaging 1.00
Z1186:Rnf112 UTSW 11 61450949 missense unknown
Z1187:Rnf112 UTSW 11 61450949 missense unknown
Z1188:Rnf112 UTSW 11 61450949 missense unknown
Z1189:Rnf112 UTSW 11 61450949 missense unknown
Z1190:Rnf112 UTSW 11 61450949 missense unknown
Z1191:Rnf112 UTSW 11 61450949 missense unknown
Z1192:Rnf112 UTSW 11 61450949 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCGCTCATTACCTCATCAG -3'
(R):5'- AGGCAGTAAGTGTTCCAGGG -3'

Sequencing Primer
(F):5'- TCATCAGGAGAGTTGAAACTGGGC -3'
(R):5'- TTCCAGGGGTGGAGACTTCC -3'
Posted On2018-11-06