Mutagenetix > Incidental Mutations

Incidental Mutation 'R6906:Cntnap5c'

538801

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5c

Ensembl Gene

ENSMUSG00000038048

Gene Name

contactin associated protein-like 5C

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R6906 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57769570-58410355 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58395307 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1207 (N1207K)

Ref Sequence

ENSEMBL: ENSMUSP00000075416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076038]

Predicted Effect

probably benign
Transcript: ENSMUST00000076038
AA Change: N1207K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: N1207K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	29	174	1.26e-10	SMART
LamG	201	338	1.57e-29	SMART
LamG	387	521	3e-26	SMART
EGF	549	583	1.88e-1	SMART
Blast:FBG	586	769	8e-83	BLAST
LamG	811	938	4.37e-28	SMART
EGF	959	995	6.55e-1	SMART
LamG	1036	1172	2.08e-11	SMART
transmembrane domain	1240	1262	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

98% (45/46)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf2	A	G	5: 24,568,842	F350L	possibly damaging	Het
Ahnak2	T	A	12: 112,785,313	T305S	probably benign	Het
Anp32a	A	G	9: 62,377,569		probably benign	Het
Aplf	A	G	6: 87,630,086	S449P	possibly damaging	Het
Arl6ip4	A	G	5: 124,116,551	R36G	possibly damaging	Het
Ascc1	G	A	10: 60,004,852	D12N	probably benign	Het
Bin1	C	A	18: 32,421,925	H243Q	probably benign	Het
Ccdc7a	C	A	8: 128,935,681	V547L	unknown	Het
Coro7	C	A	16: 4,633,304	R507L	probably benign	Het
Crtap	T	A	9: 114,381,632	K291N	probably benign	Het
Csmd3	T	C	15: 47,847,173	T1569A	probably benign	Het
Dmrta1	A	G	4: 89,691,966	T388A	probably benign	Het
Ehd3	T	C	17: 73,830,338	F501L	probably damaging	Het
Fam126a	A	T	5: 23,999,958	W12R	probably damaging	Het
Fam160a2	G	A	7: 105,388,269	T369I	probably damaging	Het
Fbn2	A	C	18: 58,071,819	L1184R	possibly damaging	Het
Gm8251	C	T	1: 44,056,013	S1975N	probably benign	Het
Hsf1	T	C	15: 76,477,719		probably null	Het
Kansl1l	T	C	1: 66,723,278	H810R	possibly damaging	Het
Lrp5	A	T	19: 3,622,638	I557N	probably damaging	Het
Lypd1	T	C	1: 125,910,459	E41G	probably damaging	Het
Mgam	A	G	6: 40,747,919	Y443C	probably damaging	Het
Muc2	A	G	7: 141,698,733	D871G	probably damaging	Het
Nup85	T	A	11: 115,580,943	Y198N	probably damaging	Het
Obscn	T	A	11: 59,032,918	M6578L	possibly damaging	Het
Olfr1097	T	C	2: 86,890,747	T143A	probably benign	Het
Osbpl5	G	C	7: 143,694,328	Q667E	probably damaging	Het
Ovgp1	T	A	3: 105,986,873		probably benign	Het
Prl8a2	T	A	13: 27,348,917	N37K	probably benign	Het
Ptprf	A	T	4: 118,269,277	I93N	possibly damaging	Het
Rnf112	T	C	11: 61,450,389	S457G	probably null	Het
Sema3e	A	G	5: 14,240,587	D562G	probably damaging	Het
Sesn3	A	G	9: 14,325,641	M472V	probably damaging	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Shc3	T	C	13: 51,466,559	T144A	probably damaging	Het
Sis	A	G	3: 72,919,485	L1287P	probably damaging	Het
Srrm2	C	T	17: 23,820,363	P2090S	probably damaging	Het
Syne2	T	G	12: 75,995,986	D3910E	possibly damaging	Het
Tcaim	C	T	9: 122,834,774	T443I	probably benign	Het
Tex19.1	T	C	11: 121,147,122	V102A	probably benign	Het
Tpd52l1	T	G	10: 31,332,954	T168P	possibly damaging	Het
Trdn	G	A	10: 33,233,948	C294Y	probably benign	Het
Trmt1l	T	C	1: 151,452,175	Y479H	probably benign	Het
Vmn1r171	G	A	7: 23,632,379	V10I	probably benign	Het
Zbtb41	T	A	1: 139,423,390	D80E	possibly damaging	Het
Zcchc4	A	G	5: 52,823,634	K473E	possibly damaging	Het

Other mutations in Cntnap5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Cntnap5c	APN	17	58162277	missense	probably benign	0.00
IGL00543:Cntnap5c	APN	17	58294350	missense	probably benign
IGL00679:Cntnap5c	APN	17	58055678	missense	probably damaging	0.98
IGL00942:Cntnap5c	APN	17	57769598	missense	probably benign	0.03
IGL01352:Cntnap5c	APN	17	58293901	missense	probably benign	0.00
IGL01822:Cntnap5c	APN	17	58055705	missense	probably damaging	0.99
IGL01864:Cntnap5c	APN	17	58410242	missense	probably benign
IGL01922:Cntnap5c	APN	17	58330119	missense	possibly damaging	0.95
IGL02111:Cntnap5c	APN	17	58102108	missense	probably damaging	1.00
IGL02112:Cntnap5c	APN	17	58313858	missense	probably benign	0.00
IGL02259:Cntnap5c	APN	17	58034862	missense	probably damaging	0.98
IGL02270:Cntnap5c	APN	17	58034853	missense	probably benign	0.08
IGL02312:Cntnap5c	APN	17	58138699	missense	probably benign	0.09
IGL02456:Cntnap5c	APN	17	58407744	splice site	probably benign
IGL02755:Cntnap5c	APN	17	58364194	missense	probably benign	0.02
IGL02955:Cntnap5c	APN	17	57892102	splice site	probably benign
IGL03001:Cntnap5c	APN	17	58055639	missense	probably damaging	1.00
IGL03012:Cntnap5c	APN	17	58359234	missense	probably benign	0.01
IGL03243:Cntnap5c	APN	17	58102176	missense	probably benign	0.01
IGL03375:Cntnap5c	APN	17	58162205	missense	possibly damaging	0.94
IGL02802:Cntnap5c	UTSW	17	58305684	missense	probably benign	0.04
LCD18:Cntnap5c	UTSW	17	58162160	intron	probably benign
R0003:Cntnap5c	UTSW	17	58199017	missense	probably benign
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0179:Cntnap5c	UTSW	17	57769625	missense	probably benign	0.19
R0244:Cntnap5c	UTSW	17	58102168	missense	probably damaging	1.00
R0445:Cntnap5c	UTSW	17	58104743	missense	probably benign	0.01
R0626:Cntnap5c	UTSW	17	58042427	missense	probably benign	0.29
R0675:Cntnap5c	UTSW	17	58034995	missense	probably damaging	1.00
R0681:Cntnap5c	UTSW	17	58305555	missense	possibly damaging	0.91
R0699:Cntnap5c	UTSW	17	58042498	missense	probably damaging	1.00
R0927:Cntnap5c	UTSW	17	58042558	missense	possibly damaging	0.78
R1081:Cntnap5c	UTSW	17	58305525	missense	possibly damaging	0.90
R1132:Cntnap5c	UTSW	17	58294356	missense	probably damaging	1.00
R1175:Cntnap5c	UTSW	17	58364246	missense	possibly damaging	0.51
R1640:Cntnap5c	UTSW	17	58395294	missense	probably benign	0.01
R1664:Cntnap5c	UTSW	17	58293990	missense	probably benign	0.00
R1758:Cntnap5c	UTSW	17	58042550	missense	probably damaging	1.00
R1785:Cntnap5c	UTSW	17	58162291	missense	probably benign	0.00
R1789:Cntnap5c	UTSW	17	58013921	missense	probably damaging	1.00
R1968:Cntnap5c	UTSW	17	58359296	missense	probably damaging	1.00
R2041:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R2041:Cntnap5c	UTSW	17	58198989	missense	probably benign	0.02
R2073:Cntnap5c	UTSW	17	58305552	missense	possibly damaging	0.58
R2093:Cntnap5c	UTSW	17	58199000	missense	probably benign	0.00
R2134:Cntnap5c	UTSW	17	58407722	missense	probably damaging	1.00
R2153:Cntnap5c	UTSW	17	58055671	missense	possibly damaging	0.90
R2176:Cntnap5c	UTSW	17	58013946	missense	probably benign	0.04
R2256:Cntnap5c	UTSW	17	58330315	missense	probably benign	0.00
R2847:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2848:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2850:Cntnap5c	UTSW	17	58410348	utr 3 prime	probably benign
R3008:Cntnap5c	UTSW	17	58359209	missense	probably damaging	1.00
R3714:Cntnap5c	UTSW	17	57892067	nonsense	probably null
R3720:Cntnap5c	UTSW	17	58330202	missense	probably benign
R3755:Cntnap5c	UTSW	17	58104599	missense	possibly damaging	0.82
R4001:Cntnap5c	UTSW	17	58407740	critical splice donor site	probably null
R4619:Cntnap5c	UTSW	17	58410268	missense	probably benign
R5146:Cntnap5c	UTSW	17	58013847	missense	probably damaging	0.96
R5309:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5312:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5722:Cntnap5c	UTSW	17	58313857	missense	probably benign	0.01
R5974:Cntnap5c	UTSW	17	57876485	missense	probably benign	0.00
R6017:Cntnap5c	UTSW	17	58104698	missense	probably benign	0.41
R6059:Cntnap5c	UTSW	17	58313712	missense	probably damaging	0.99
R6152:Cntnap5c	UTSW	17	58286886	missense	possibly damaging	0.65
R6182:Cntnap5c	UTSW	17	57876395	missense	probably benign	0.00
R6298:Cntnap5c	UTSW	17	58104752	missense	probably damaging	1.00
R6301:Cntnap5c	UTSW	17	57892037	missense	probably benign	0.01
R6514:Cntnap5c	UTSW	17	58330170	missense	probably damaging	0.96
R6583:Cntnap5c	UTSW	17	58330277	missense	probably damaging	1.00
R6688:Cntnap5c	UTSW	17	58293904	missense	possibly damaging	0.71
R6781:Cntnap5c	UTSW	17	58138653	nonsense	probably null
R6866:Cntnap5c	UTSW	17	58092294	missense	probably benign
R6911:Cntnap5c	UTSW	17	57892014	missense	probably damaging	1.00
R6919:Cntnap5c	UTSW	17	58293953	missense	probably benign	0.02
R6923:Cntnap5c	UTSW	17	58092350	missense	possibly damaging	0.96
R6925:Cntnap5c	UTSW	17	58395266	missense	probably benign	0.39
R6982:Cntnap5c	UTSW	17	58092252	missense	possibly damaging	0.77
R7144:Cntnap5c	UTSW	17	58286888	missense	probably benign
R7422:Cntnap5c	UTSW	17	58410231	nonsense	probably null
R7797:Cntnap5c	UTSW	17	58359275	missense	probably benign	0.11
R7830:Cntnap5c	UTSW	17	58162250	missense	probably damaging	1.00
R8169:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R8351:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8352:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8451:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8452:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
RF010:Cntnap5c	UTSW	17	58286795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATCCAGAAGTTGCTAGAGC -3'
(R):5'- TGCTATTGTAGTGCTCATACCC -3'

Sequencing Primer
(F):5'- CTAGAGCAAACACCTTGGGTTTTG -3'
(R):5'- AAAAGCTGCCCACTGTGGTTG -3'

Posted On

2018-11-06