Incidental Mutation 'R6907:Slc19a2'
ID538806
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164262754 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 253 (T253I)
Ref Sequence ENSEMBL: ENSMUSP00000131327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
Predicted Effect probably benign
Transcript: ENSMUST00000044021
AA Change: T454I

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: T454I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159230
AA Change: T416I

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: T416I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169394
AA Change: T253I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918
AA Change: T253I

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164256798 missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164263456 missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6300:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164257225 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCACATTTCAGAAAGGGAGTTAGC -3'
(R):5'- TGGTCCCAACATTCTCCACAG -3'

Sequencing Primer
(F):5'- AACAGTTTAGGAGGAGGTTTGGGTAC -3'
(R):5'- TCTCCACAGAAAAGACCTAAGAATGG -3'
Posted On2018-11-06