Incidental Mutation 'R6907:Ntng2'
ID538807
Institutional Source Beutler Lab
Gene Symbol Ntng2
Ensembl Gene ENSMUSG00000035513
Gene Namenetrin G2
SynonymsLmnt2, 2610016D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29194541-29253005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29228206 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 77 (C77R)
Ref Sequence ENSEMBL: ENSMUSP00000139034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048455] [ENSMUST00000071201] [ENSMUST00000091153] [ENSMUST00000102873] [ENSMUST00000177689] [ENSMUST00000183583]
Predicted Effect probably damaging
Transcript: ENSMUST00000048455
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035468
Gene: ENSMUSG00000035513
AA Change: C77R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 372 385 N/A INTRINSIC
EGF_Lam 413 466 5.28e-5 SMART
EGF_Lam 469 511 4.12e-7 SMART
EGF 515 547 2.26e-4 SMART
low complexity region 574 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071201
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071190
Gene: ENSMUSG00000035513
AA Change: C77R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 346 9.19e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091153
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088688
Gene: ENSMUSG00000035513
AA Change: C77R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 388 441 5.28e-5 SMART
EGF_Lam 444 486 4.12e-7 SMART
EGF 490 522 2.26e-4 SMART
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102873
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099937
Gene: ENSMUSG00000035513
AA Change: C77R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177689
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136659
Gene: ENSMUSG00000035513
AA Change: C77R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
EGF_Lam 354 407 5.28e-5 SMART
EGF_Lam 410 452 4.12e-7 SMART
EGF 456 488 2.26e-4 SMART
low complexity region 515 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183583
AA Change: C77R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139034
Gene: ENSMUSG00000035513
AA Change: C77R

DomainStartEndE-ValueType
LamNT 33 285 2.79e-15 SMART
EGF_Lam 287 344 1.41e-5 SMART
low complexity region 345 368 N/A INTRINSIC
Meta Mutation Damage Score 0.9422 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a subclass of the netrin family called netrin-G proteins. Unlike classic netrins, which act as diffusible chemoattractants, netrin-Gs are glycosylphosphatidylinositol-anchored membrane proteins that interact with specific transmembrane proteins. In mouse, this gene is preferentially expressed in the cerebral cortex, habenular nucleus and superior colliculus. Knockout mutant mice display a lack of behavioral startle in response to acoustic stimuli. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an absence of startle reflex and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Ntng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0388:Ntng2 UTSW 2 29207426 missense probably damaging 1.00
R0526:Ntng2 UTSW 2 29197062 missense probably damaging 1.00
R1835:Ntng2 UTSW 2 29197057 nonsense probably null
R1961:Ntng2 UTSW 2 29197098 missense probably damaging 1.00
R2507:Ntng2 UTSW 2 29207519 missense probably damaging 1.00
R2920:Ntng2 UTSW 2 29204211 missense probably benign
R3944:Ntng2 UTSW 2 29204277 missense probably benign 0.02
R3954:Ntng2 UTSW 2 29207535 missense probably damaging 0.97
R6235:Ntng2 UTSW 2 29227979 missense probably damaging 1.00
R6742:Ntng2 UTSW 2 29200928 missense probably benign
R6751:Ntng2 UTSW 2 29228043 missense possibly damaging 0.89
R6774:Ntng2 UTSW 2 29197090 missense probably damaging 1.00
R6964:Ntng2 UTSW 2 29197029 missense probably benign 0.02
R6995:Ntng2 UTSW 2 29197068 missense probably damaging 1.00
R7214:Ntng2 UTSW 2 29227720 missense probably damaging 0.99
R7249:Ntng2 UTSW 2 29227992 missense probably benign 0.03
R7825:Ntng2 UTSW 2 29204078 missense probably benign 0.00
R8337:Ntng2 UTSW 2 29248038 start codon destroyed probably null 0.88
X0023:Ntng2 UTSW 2 29197063 nonsense probably null
X0028:Ntng2 UTSW 2 29197149 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACGTCGTCTGTCAACTCCAC -3'
(R):5'- TGGGCTTATAGAACACGCAGTAG -3'

Sequencing Primer
(F):5'- CACGCTCTTGTTCCATGAGAGG -3'
(R):5'- GTGCAGAGTACCTAAGACCC -3'
Posted On2018-11-06