Incidental Mutation 'R6907:Exd1'
ID538809
Institutional Source Beutler Lab
Gene Symbol Exd1
Ensembl Gene ENSMUSG00000048647
Gene Nameexonuclease 3'-5' domain containing 1
SynonymsExdl1, 4932702D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119516505-119547627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119533476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000126713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060009] [ENSMUST00000171024]
Predicted Effect probably damaging
Transcript: ENSMUST00000060009
AA Change: V137A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054980
Gene: ENSMUSG00000048647
AA Change: V137A

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171024
AA Change: V137A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126713
Gene: ENSMUSG00000048647
AA Change: V137A

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are fertile and viable, but exhibit defective biogenesis of antisense piRNAs and activation of transposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Exd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Exd1 APN 2 119530079 splice site probably benign
IGL02032:Exd1 APN 2 119533467 missense probably damaging 1.00
IGL02040:Exd1 APN 2 119540065 missense possibly damaging 0.79
IGL02831:Exd1 APN 2 119528754 missense probably damaging 1.00
IGL03008:Exd1 APN 2 119520381 missense probably benign 0.01
R0350:Exd1 UTSW 2 119523566 missense possibly damaging 0.64
R1423:Exd1 UTSW 2 119540013 splice site probably benign
R1466:Exd1 UTSW 2 119520734 splice site probably benign
R1524:Exd1 UTSW 2 119524674 missense probably damaging 0.98
R2011:Exd1 UTSW 2 119528663 intron probably benign
R2026:Exd1 UTSW 2 119520305 missense probably benign
R4711:Exd1 UTSW 2 119538751 missense possibly damaging 0.91
R4827:Exd1 UTSW 2 119520326 missense probably benign
R4828:Exd1 UTSW 2 119520326 missense probably benign
R4829:Exd1 UTSW 2 119520326 missense probably benign
R4830:Exd1 UTSW 2 119520326 missense probably benign
R5799:Exd1 UTSW 2 119538781 missense probably benign 0.01
R6570:Exd1 UTSW 2 119520173 missense probably benign
R6654:Exd1 UTSW 2 119524717 critical splice acceptor site probably null
R7325:Exd1 UTSW 2 119520139 missense probably benign 0.28
R7684:Exd1 UTSW 2 119520203 missense probably damaging 1.00
R7921:Exd1 UTSW 2 119530099 missense probably damaging 0.99
R8029:Exd1 UTSW 2 119528723 missense probably damaging 1.00
R8428:Exd1 UTSW 2 119538867 missense possibly damaging 0.80
R8516:Exd1 UTSW 2 119520073 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTTACTAGGGAAAGCATCAAGATC -3'
(R):5'- AAAGTGCTTTGTCTTGATCAGG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- CTTGATCAGGCAAGATGGGTC -3'
Posted On2018-11-06