Incidental Mutation 'R6907:Sfpq'
ID538812
Institutional Source Beutler Lab
Gene Symbol Sfpq
Ensembl Gene ENSMUSG00000028820
Gene Namesplicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms2810416M14Rik, PSF, 1110004P21Rik, 5730453G22Rik, REP1, D4Ertd314e, 9030402K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6907 (G1)
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location127021324-127037013 bp(+) (GRCm38)
Type of Mutationsmall deletion (5 aa in frame mutation)
DNA Base Change (assembly) GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC to GCCGCCGCAGCAGCC at 127021626 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030623]
Predicted Effect probably benign
Transcript: ENSMUST00000030623
SMART Domains Protein: ENSMUSP00000030623
Gene: ENSMUSG00000028820

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 48 101 N/A INTRINSIC
low complexity region 105 236 N/A INTRINSIC
low complexity region 238 258 N/A INTRINSIC
RRM 290 357 3.97e-18 SMART
RRM 364 440 3.83e-11 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 554 587 N/A INTRINSIC
low complexity region 595 614 N/A INTRINSIC
low complexity region 617 639 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 682 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele die. Heterozygous mice show abnormality in entrainment of circadian rhythm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Sfpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Sfpq APN 4 127023688 missense possibly damaging 0.80
IGL00578:Sfpq APN 4 127025907 missense probably damaging 1.00
IGL01301:Sfpq APN 4 127026760 splice site probably benign
IGL02385:Sfpq APN 4 127026136 splice site probably null
IGL03373:Sfpq APN 4 127026785 missense possibly damaging 0.92
R0645:Sfpq UTSW 4 127022969 missense possibly damaging 0.75
R2038:Sfpq UTSW 4 127021502 missense unknown
R3120:Sfpq UTSW 4 127022133 missense unknown
R4609:Sfpq UTSW 4 127021611 missense unknown
R4788:Sfpq UTSW 4 127025998 missense probably damaging 1.00
R5034:Sfpq UTSW 4 127023669 splice site probably benign
R5411:Sfpq UTSW 4 127021723 missense unknown
R6115:Sfpq UTSW 4 127021348 start gained probably null
R6906:Sfpq UTSW 4 127021626 small deletion probably benign
R6908:Sfpq UTSW 4 127021626 small deletion probably benign
R6929:Sfpq UTSW 4 127021626 small deletion probably benign
R6933:Sfpq UTSW 4 127021626 small deletion probably benign
R7029:Sfpq UTSW 4 127029882 missense probably benign 0.23
R7124:Sfpq UTSW 4 127025932 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATGTCTCGGGATCGGTTCC -3'
(R):5'- GAGATCTTCTCCTCCGTGCG -3'

Sequencing Primer
(F):5'- ATCGGTTCCGGAGTCGC -3'
(R):5'- TCGAGACTCCGCTGCTC -3'
Posted On2018-11-06