Incidental Mutation 'R6907:Ppm1k'
ID538818
Institutional Source Beutler Lab
Gene Symbol Ppm1k
Ensembl Gene ENSMUSG00000037826
Gene Nameprotein phosphatase 1K (PP2C domain containing)
SynonymsA930026L03Rik, 2900063A19Rik, PP2Cm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location57506502-57535468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57510770 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 356 (E356A)
Ref Sequence ENSEMBL: ENSMUSP00000041395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042766]
Predicted Effect probably benign
Transcript: ENSMUST00000042766
AA Change: E356A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000041395
Gene: ENSMUSG00000037826
AA Change: E356A

DomainStartEndE-ValueType
PP2Cc 88 344 2.16e-68 SMART
PP2C_SIG 93 346 1.15e-3 SMART
low complexity region 359 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204607
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit defective amino acid metabolism, increased oxidative stress, and increased mortality when subjected to a high-protein diet while in utero and during postnatal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Ppm1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ppm1k APN 6 57524755 missense probably benign 0.05
IGL01395:Ppm1k APN 6 57513958 missense probably benign
IGL01923:Ppm1k APN 6 57522828 missense probably benign 0.01
IGL02484:Ppm1k APN 6 57525012 missense possibly damaging 0.59
IGL03149:Ppm1k APN 6 57524774 missense probably damaging 0.99
IGL03340:Ppm1k APN 6 57510726 missense probably damaging 1.00
R1230:Ppm1k UTSW 6 57525074 missense probably benign
R1425:Ppm1k UTSW 6 57524789 missense probably damaging 1.00
R1522:Ppm1k UTSW 6 57525157 missense possibly damaging 0.48
R3508:Ppm1k UTSW 6 57514990 missense probably damaging 0.99
R3751:Ppm1k UTSW 6 57524860 missense probably benign 0.01
R4845:Ppm1k UTSW 6 57522768 nonsense probably null
R4914:Ppm1k UTSW 6 57510777 missense probably damaging 0.99
R4915:Ppm1k UTSW 6 57510777 missense probably damaging 0.99
R4918:Ppm1k UTSW 6 57510777 missense probably damaging 0.99
R5430:Ppm1k UTSW 6 57524886 nonsense probably null
R6962:Ppm1k UTSW 6 57515660 missense probably damaging 0.99
R7943:Ppm1k UTSW 6 57524828 missense probably benign 0.14
X0024:Ppm1k UTSW 6 57514010 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAGTTGACCATAATGATG -3'
(R):5'- TAGAACCAGTTGGCCTTCCAG -3'

Sequencing Primer
(F):5'- TGAAAATACTACTGGGTATGTGGC -3'
(R):5'- CCAGTTGGCCTTCCAGAGAAAG -3'
Posted On2018-11-06