Incidental Mutation 'R6907:Olfr476'
ID538820
Institutional Source Beutler Lab
Gene Symbol Olfr476
Ensembl Gene ENSMUSG00000095301
Gene Nameolfactory receptor 476
SynonymsMOR204-3, GA_x6K02T2PBJ9-10296787-10297719
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107964803-107969514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107968252 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 285 (L285P)
Ref Sequence ENSEMBL: ENSMUSP00000149760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077249] [ENSMUST00000217173]
Predicted Effect probably damaging
Transcript: ENSMUST00000077249
AA Change: L285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076485
Gene: ENSMUSG00000095301
AA Change: L285P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 290 4.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217173
AA Change: L285P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Olfr476
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr476 APN 7 107967534 missense probably damaging 1.00
IGL01403:Olfr476 APN 7 107967621 missense possibly damaging 0.64
IGL01564:Olfr476 APN 7 107967991 missense probably benign 0.11
IGL01615:Olfr476 APN 7 107967937 missense probably damaging 1.00
IGL01777:Olfr476 APN 7 107967502 missense probably damaging 1.00
IGL01999:Olfr476 APN 7 107967468 missense probably benign
IGL02239:Olfr476 APN 7 107968047 missense probably damaging 1.00
R0636:Olfr476 UTSW 7 107967472 missense probably benign 0.00
R1986:Olfr476 UTSW 7 107967670 missense probably benign
R5109:Olfr476 UTSW 7 107967897 missense probably benign 0.06
R6363:Olfr476 UTSW 7 107967750 missense possibly damaging 0.57
R6526:Olfr476 UTSW 7 107967462 missense probably benign 0.03
R7063:Olfr476 UTSW 7 107968204 missense probably benign
R7218:Olfr476 UTSW 7 107967667 missense probably benign
R7240:Olfr476 UTSW 7 107968188 missense probably benign 0.42
R7444:Olfr476 UTSW 7 107967604 missense probably damaging 0.99
R7939:Olfr476 UTSW 7 107967779 nonsense probably null
R8060:Olfr476 UTSW 7 107967405 missense probably benign
X0025:Olfr476 UTSW 7 107968188 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTACATTCTCATCACCATCCTGAAG -3'
(R):5'- ACATGACAGATACCAAGAAGTGTTC -3'

Sequencing Primer
(F):5'- ATCCTGAAGATGCGCTCCACTG -3'
(R):5'- TTCAAGTGTATAAAGGGAAGTTGATG -3'
Posted On2018-11-06