Incidental Mutation 'R6907:Adat1'
ID538824
Institutional Source Beutler Lab
Gene Symbol Adat1
Ensembl Gene ENSMUSG00000031949
Gene Nameadenosine deaminase, tRNA-specific 1
SynonymsmADAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111966908-111992302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111972161 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 344 (I344V)
Ref Sequence ENSEMBL: ENSMUSP00000113201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034427] [ENSMUST00000120457] [ENSMUST00000139820]
Predicted Effect silent
Transcript: ENSMUST00000034427
SMART Domains Protein: ENSMUSP00000034427
Gene: ENSMUSG00000031949

DomainStartEndE-ValueType
ADEAMc 2 499 4.19e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120457
AA Change: I344V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113201
Gene: ENSMUSG00000031949
AA Change: I344V

DomainStartEndE-ValueType
Pfam:A_deamin 63 354 8.1e-86 PFAM
Predicted Effect silent
Transcript: ENSMUST00000139820
SMART Domains Protein: ENSMUSP00000117279
Gene: ENSMUSG00000031949

DomainStartEndE-ValueType
ADEAMc 2 453 1e-141 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Adat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Adat1 APN 8 111982310 missense probably damaging 1.00
R0212:Adat1 UTSW 8 111987208 missense possibly damaging 0.50
R0559:Adat1 UTSW 8 111982430 missense probably damaging 1.00
R1521:Adat1 UTSW 8 111987235 missense possibly damaging 0.66
R1972:Adat1 UTSW 8 111990418 unclassified probably benign
R2217:Adat1 UTSW 8 111982496 missense probably benign 0.00
R3807:Adat1 UTSW 8 111990370 missense probably damaging 1.00
R4497:Adat1 UTSW 8 111979362 missense probably benign 0.06
R4553:Adat1 UTSW 8 111990280 missense probably damaging 1.00
R5702:Adat1 UTSW 8 111978072 missense probably benign 0.37
R5960:Adat1 UTSW 8 111982601 missense probably benign 0.00
R6380:Adat1 UTSW 8 111978072 missense probably benign 0.37
R6538:Adat1 UTSW 8 111968462 missense probably benign
R7022:Adat1 UTSW 8 111989862 missense probably damaging 1.00
R7440:Adat1 UTSW 8 111989898 missense probably damaging 0.99
R7606:Adat1 UTSW 8 111982604 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTCTCTGGGTAAGCAGTAAGC -3'
(R):5'- AGACTGCGTCTCAGCTGTAG -3'

Sequencing Primer
(F):5'- GCAGTAAGCACCCACTGG -3'
(R):5'- TCTCAGCTGTAGGGTCTCAGC -3'
Posted On2018-11-06