Incidental Mutation 'R6907:Myo1e'
ID538828
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70327155 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 263 (N263K)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034745
AA Change: N263K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: N263K

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 splice site probably null
R5414:Myo1e UTSW 9 70322358 splice site probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
R7811:Myo1e UTSW 9 70327262 missense probably damaging 0.96
R7962:Myo1e UTSW 9 70335219 missense possibly damaging 0.64
R8309:Myo1e UTSW 9 70346763 missense possibly damaging 0.90
R8510:Myo1e UTSW 9 70335265 missense probably damaging 1.00
R8513:Myo1e UTSW 9 70320088 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTGAGTGACTACCCAGCTCAC -3'
(R):5'- CATGCACCTCACTAGCAATCTAGG -3'

Sequencing Primer
(F):5'- CACTGATCACCTTGTTTGATGGAGAC -3'
(R):5'- CTAGCAATCTAGGCCAATCAAAGGG -3'
Posted On2018-11-06