Incidental Mutation 'R6907:Cactin'
ID538829
Institutional Source Beutler Lab
Gene Symbol Cactin
Ensembl Gene ENSMUSG00000034889
Gene Namecactin, spliceosome C complex subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81321103-81326242 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 81323444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000050867] [ENSMUST00000161854] [ENSMUST00000163075] [ENSMUST00000218120]
Predicted Effect probably benign
Transcript: ENSMUST00000045469
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050867
SMART Domains Protein: ENSMUSP00000059533
Gene: ENSMUSG00000034889

DomainStartEndE-ValueType
low complexity region 9 101 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
coiled coil region 157 184 N/A INTRINSIC
low complexity region 186 206 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Pfam:Cactin_mid 292 479 2.1e-68 PFAM
low complexity region 507 524 N/A INTRINSIC
low complexity region 531 558 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
CactinC_cactus 648 772 2.13e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163075
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218120
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Cactin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Cactin APN 10 81324350 missense possibly damaging 0.93
IGL01631:Cactin APN 10 81323224 missense probably benign 0.03
IGL01816:Cactin APN 10 81325865 missense possibly damaging 0.81
IGL02484:Cactin APN 10 81322974 missense probably benign 0.09
IGL03001:Cactin APN 10 81325734 missense probably damaging 1.00
R0241:Cactin UTSW 10 81322652 missense probably benign
R0241:Cactin UTSW 10 81322652 missense probably benign
R0326:Cactin UTSW 10 81322662 missense probably benign 0.01
R0570:Cactin UTSW 10 81323233 missense probably damaging 0.98
R0591:Cactin UTSW 10 81324003 nonsense probably null
R1429:Cactin UTSW 10 81323678 missense probably damaging 1.00
R1444:Cactin UTSW 10 81322436 splice site probably null
R1470:Cactin UTSW 10 81323151 nonsense probably null
R1470:Cactin UTSW 10 81323151 nonsense probably null
R1630:Cactin UTSW 10 81323725 missense probably benign 0.26
R2022:Cactin UTSW 10 81322893 missense possibly damaging 0.94
R3401:Cactin UTSW 10 81325875 missense probably benign 0.07
R3402:Cactin UTSW 10 81325875 missense probably benign 0.07
R3403:Cactin UTSW 10 81325875 missense probably benign 0.07
R5284:Cactin UTSW 10 81323762 missense probably damaging 1.00
R6126:Cactin UTSW 10 81324309 missense possibly damaging 0.61
R6127:Cactin UTSW 10 81324309 missense possibly damaging 0.61
R7339:Cactin UTSW 10 81321318 unclassified probably benign
R7340:Cactin UTSW 10 81321318 unclassified probably benign
R7558:Cactin UTSW 10 81321318 unclassified probably benign
R7625:Cactin UTSW 10 81321318 unclassified probably benign
R7627:Cactin UTSW 10 81321318 unclassified probably benign
R7904:Cactin UTSW 10 81325865 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCTGGCCTTCTATTGGAAAC -3'
(R):5'- TCTGCGCTGATGTACTTGGC -3'

Sequencing Primer
(F):5'- CTGGCCTTCTATTGGAAACTACAATC -3'
(R):5'- CCATCTCGGATTCGGATCTTGGAG -3'
Posted On2018-11-06