Incidental Mutation 'R6907:Traf4'
ID538832
Institutional Source Beutler Lab
Gene Symbol Traf4
Ensembl Gene ENSMUSG00000017386
Gene NameTNF receptor associated factor 4
SynonymsCART1, A530032M13Rik, msp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78158499-78165589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78160442 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 296 (R296Q)
Ref Sequence ENSEMBL: ENSMUSP00000017530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000073705] [ENSMUST00000100782] [ENSMUST00000155571]
Predicted Effect probably benign
Transcript: ENSMUST00000017530
AA Change: R296Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386
AA Change: R296Q

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073705
SMART Domains Protein: ENSMUSP00000073384
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 5.6e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100782
SMART Domains Protein: ENSMUSP00000126620
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 1 434 1.9e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155571
SMART Domains Protein: ENSMUSP00000121832
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 3.2e-259 PFAM
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show respiratory problems, various skeletal defects, spina bifida and partial lethality around embryonic day 14. Homozygotes for an ENU-induced mutation exhibit postnatal lethality and hypopigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Traf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01354:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01361:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01375:Traf4 APN 11 78160082 missense probably benign 0.00
IGL01991:Traf4 APN 11 78160046 missense possibly damaging 0.87
IGL02243:Traf4 APN 11 78160517 missense probably benign 0.00
IGL02800:Traf4 APN 11 78160235 missense possibly damaging 0.67
IGL02883:Traf4 APN 11 78161621 missense possibly damaging 0.72
PIT4453001:Traf4 UTSW 11 78161534 missense probably benign
R2104:Traf4 UTSW 11 78160014 missense probably damaging 0.99
R2199:Traf4 UTSW 11 78159980 missense probably damaging 1.00
R2298:Traf4 UTSW 11 78160851 missense probably benign 0.08
R2351:Traf4 UTSW 11 78160176 missense probably damaging 1.00
R4547:Traf4 UTSW 11 78161037 missense possibly damaging 0.85
R4854:Traf4 UTSW 11 78161520 nonsense probably null
R6905:Traf4 UTSW 11 78160442 missense probably benign 0.03
R7384:Traf4 UTSW 11 78160791 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGAGGAATGCAGACACCTG -3'
(R):5'- ATGGGTCCTGCTAGTCAACTC -3'

Sequencing Primer
(F):5'- AGACACCTGCAGCTTGTAG -3'
(R):5'- TCCTGTGGAACTAGGTGCC -3'
Posted On2018-11-06