Incidental Mutation 'R6907:Nfe2l1'
ID538833
Institutional Source Beutler Lab
Gene Symbol Nfe2l1
Ensembl Gene ENSMUSG00000038615
Gene Namenuclear factor, erythroid derived 2,-like 1
SynonymsLCR-F1, TCF11, NRF1, TCF-11, Lcrf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location96817414-96829968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96819810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 373 (L373P)
Ref Sequence ENSEMBL: ENSMUSP00000127804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081775] [ENSMUST00000107657] [ENSMUST00000107658] [ENSMUST00000107659] [ENSMUST00000126949] [ENSMUST00000142065] [ENSMUST00000167110] [ENSMUST00000167149] [ENSMUST00000169828]
Predicted Effect probably damaging
Transcript: ENSMUST00000081775
AA Change: L531P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080467
Gene: ENSMUSG00000038615
AA Change: L531P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107657
AA Change: L531P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103284
Gene: ENSMUSG00000038615
AA Change: L531P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107658
AA Change: L531P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103285
Gene: ENSMUSG00000038615
AA Change: L531P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107659
AA Change: L531P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103286
Gene: ENSMUSG00000038615
AA Change: L531P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 697 1.93e-7 SMART
transmembrane domain 719 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126949
SMART Domains Protein: ENSMUSP00000120512
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
SCOP:d1e5xa_ 22 65 4e-3 SMART
low complexity region 114 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142065
SMART Domains Protein: ENSMUSP00000121423
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000167110
AA Change: L373P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127804
Gene: ENSMUSG00000038615
AA Change: L373P

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-9 PDB
low complexity region 244 257 N/A INTRINSIC
low complexity region 287 334 N/A INTRINSIC
BRLZ 463 527 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167149
AA Change: L531P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128527
Gene: ENSMUSG00000038615
AA Change: L531P

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169828
AA Change: L243P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131585
Gene: ENSMUSG00000038615
AA Change: L243P

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 157 204 N/A INTRINSIC
BRLZ 333 397 9.8e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases from the use of NRF1 for this gene, NFE2L1, and for "nuclear respiratory factor 1" which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations fail to form a primitive streak, lack mesoderm, show a non-cell autonomous defect in definitive erythropoiesis, and die around embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Nfe2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Nfe2l1 APN 11 96817716 missense probably benign 0.23
IGL02676:Nfe2l1 APN 11 96827665 missense probably damaging 0.97
IGL02868:Nfe2l1 APN 11 96820140 missense probably damaging 1.00
IGL03278:Nfe2l1 APN 11 96822192 missense probably benign 0.04
R0218:Nfe2l1 UTSW 11 96827613 missense probably damaging 1.00
R0453:Nfe2l1 UTSW 11 96827368 missense probably damaging 0.99
R0637:Nfe2l1 UTSW 11 96827688 missense probably damaging 1.00
R3891:Nfe2l1 UTSW 11 96819997 missense possibly damaging 0.93
R4108:Nfe2l1 UTSW 11 96819394 critical splice donor site probably null
R4234:Nfe2l1 UTSW 11 96819909 missense probably damaging 1.00
R4720:Nfe2l1 UTSW 11 96827689 missense probably damaging 1.00
R5102:Nfe2l1 UTSW 11 96822108 missense probably damaging 0.99
R5319:Nfe2l1 UTSW 11 96819379 missense probably damaging 0.98
R5929:Nfe2l1 UTSW 11 96827359 missense probably damaging 0.99
R6263:Nfe2l1 UTSW 11 96817744 missense probably benign 0.23
R6375:Nfe2l1 UTSW 11 96820051 missense probably damaging 1.00
R6450:Nfe2l1 UTSW 11 96827335 missense possibly damaging 0.80
R6705:Nfe2l1 UTSW 11 96827625 missense probably damaging 1.00
R7161:Nfe2l1 UTSW 11 96817720 missense probably benign 0.23
R7411:Nfe2l1 UTSW 11 96822183 missense probably benign 0.37
R7420:Nfe2l1 UTSW 11 96819913 missense probably benign 0.02
R7495:Nfe2l1 UTSW 11 96819796 missense probably damaging 0.98
R7625:Nfe2l1 UTSW 11 96819445 missense probably damaging 1.00
R8134:Nfe2l1 UTSW 11 96819759 missense possibly damaging 0.83
R8252:Nfe2l1 UTSW 11 96819232 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGGGATCTTCATGGCTCGG -3'
(R):5'- TCTCTGAGCAGCTCTGAAGG -3'

Sequencing Primer
(F):5'- ATCTTCATGGCTCGGGCTCTG -3'
(R):5'- GAAGGGAGCTCTTCTTCTTCC -3'
Posted On2018-11-06