Incidental Mutation 'R6907:Vrk1'
ID 538835
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Name vaccinia related kinase 1
Synonyms 51PK
MMRRC Submission 044999-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.574) question?
Stock # R6907 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 105976487-106043685 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 106041291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 395 (Q395H)
Ref Sequence ENSEMBL: ENSMUSP00000071922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
AlphaFold Q80X41
Predicted Effect possibly damaging
Transcript: ENSMUST00000021539
AA Change: Q439H

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115
AA Change: Q439H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072040
AA Change: Q395H

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115
AA Change: Q395H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085026
AA Change: Q415H

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115
AA Change: Q415H

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220629
AA Change: Q439H

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000221312
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 112,698,793 (GRCm39) I344V probably benign Het
Bmper A T 9: 23,310,868 (GRCm39) Q434L probably damaging Het
Cabyr A G 18: 12,883,969 (GRCm39) Y152C probably benign Het
Cactin G A 10: 81,159,278 (GRCm39) probably null Het
Cadps2 T C 6: 23,599,505 (GRCm39) D238G probably damaging Het
Card10 T C 15: 78,671,671 (GRCm39) T598A possibly damaging Het
Ctr9 C T 7: 110,629,449 (GRCm39) P25L probably damaging Het
Entpd5 T C 12: 84,424,127 (GRCm39) T409A probably benign Het
Exd1 A G 2: 119,363,957 (GRCm39) V137A probably damaging Het
Fcgbp G A 7: 27,784,443 (GRCm39) G168R probably damaging Het
Ift88 A G 14: 57,683,067 (GRCm39) N248S probably benign Het
Kntc1 T A 5: 123,939,888 (GRCm39) Y1561N probably damaging Het
Mef2c A G 13: 83,802,730 (GRCm39) D227G probably benign Het
Myh2 C T 11: 67,084,567 (GRCm39) T1702M probably damaging Het
Myo1e T A 9: 70,234,437 (GRCm39) N263K probably benign Het
Nfe2l1 A G 11: 96,710,636 (GRCm39) L373P probably damaging Het
Nob1 C T 8: 108,142,860 (GRCm39) V274M possibly damaging Het
Ntng2 A G 2: 29,118,218 (GRCm39) C77R probably damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or10ad1c T C 15: 98,085,649 (GRCm39) N10D probably damaging Het
Or5p55 T C 7: 107,567,459 (GRCm39) L285P probably damaging Het
Pcdh7 T A 5: 57,876,471 (GRCm39) W9R possibly damaging Het
Pcdha1 A G 18: 37,064,124 (GRCm39) T263A probably benign Het
Per3 C T 4: 151,128,015 (GRCm39) probably null Het
Pgbd5 A G 8: 125,107,021 (GRCm39) F265L probably damaging Het
Ppm1k T G 6: 57,487,755 (GRCm39) E356A probably benign Het
Ptgfr G T 3: 151,540,938 (GRCm39) T190K possibly damaging Het
Sec24a A G 11: 51,603,103 (GRCm39) Y782H probably damaging Het
Setd1b T C 5: 123,301,295 (GRCm39) probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc19a2 C T 1: 164,090,323 (GRCm39) T253I possibly damaging Het
Tcf4 C T 18: 69,785,484 (GRCm39) T207M probably damaging Het
Thada T C 17: 84,700,897 (GRCm39) N1203S probably damaging Het
Tln2 A T 9: 67,304,917 (GRCm39) S5T probably damaging Het
Traf4 C T 11: 78,051,268 (GRCm39) R296Q probably benign Het
Ttbk2 A G 2: 120,655,751 (GRCm39) S38P probably benign Het
Vwa3a G T 7: 120,391,804 (GRCm39) probably benign Het
Wdsub1 C T 2: 59,692,028 (GRCm39) V335I possibly damaging Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106,024,840 (GRCm39) missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106,022,175 (GRCm39) splice site probably null
IGL02072:Vrk1 APN 12 106,009,144 (GRCm39) missense probably benign 0.04
IGL02387:Vrk1 APN 12 106,036,803 (GRCm39) missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106,017,261 (GRCm39) missense probably benign 0.00
IGL02501:Vrk1 APN 12 106,028,912 (GRCm39) missense probably benign
IGL03211:Vrk1 APN 12 106,002,847 (GRCm39) missense probably benign 0.03
R0332:Vrk1 UTSW 12 106,024,884 (GRCm39) missense probably benign 0.05
R0790:Vrk1 UTSW 12 106,036,883 (GRCm39) missense probably benign
R1897:Vrk1 UTSW 12 106,002,799 (GRCm39) splice site probably benign
R1911:Vrk1 UTSW 12 106,024,236 (GRCm39) critical splice donor site probably null
R2289:Vrk1 UTSW 12 106,024,120 (GRCm39) missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106,018,052 (GRCm39) missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106,024,231 (GRCm39) missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106,018,087 (GRCm39) missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106,039,865 (GRCm39) splice site probably null
R5366:Vrk1 UTSW 12 106,022,078 (GRCm39) missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106,018,024 (GRCm39) missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106,024,910 (GRCm39) missense probably damaging 1.00
R8154:Vrk1 UTSW 12 106,036,793 (GRCm39) missense probably benign 0.08
R8981:Vrk1 UTSW 12 106,036,953 (GRCm39) intron probably benign
R9174:Vrk1 UTSW 12 106,002,811 (GRCm39) missense probably benign 0.00
R9337:Vrk1 UTSW 12 106,024,957 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGTTAAGACTAGAAAGTAACCTGAC -3'
(R):5'- TCTGTCCAGTCTGGGAATCG -3'

Sequencing Primer
(F):5'- ACCTGACGGTTGCTAGGCTG -3'
(R):5'- CCACATGGGTTATGACGACTAAAG -3'
Posted On 2018-11-06