Incidental Mutation 'R6907:Pcdha1'
ID538843
Institutional Source Beutler Lab
Gene Symbol Pcdha1
Ensembl Gene ENSMUSG00000103442
Gene Nameprotocadherin alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36930184-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36931071 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 263 (T263A)
Ref Sequence ENSEMBL: ENSMUSP00000142308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000193839]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
AA Change: T263A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442
AA Change: T263A

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193839
AA Change: T263A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442
AA Change: T263A

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Pcdha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdha1 APN 18 36932175 missense probably damaging 0.99
R0062:Pcdha1 UTSW 18 37006628 missense probably benign 0.08
R0108:Pcdha1 UTSW 18 36998756 missense probably benign
R0543:Pcdha1 UTSW 18 37185068 missense probably damaging 1.00
R1599:Pcdha1 UTSW 18 37185237 missense probably damaging 1.00
R1717:Pcdha1 UTSW 18 36932184 missense probably benign 0.01
R2301:Pcdha1 UTSW 18 37156183 missense probably damaging 1.00
R3038:Pcdha1 UTSW 18 36931011 missense probably damaging 1.00
R3086:Pcdha1 UTSW 18 36930948 missense possibly damaging 0.95
R3693:Pcdha1 UTSW 18 36932308 missense possibly damaging 0.95
R3783:Pcdha1 UTSW 18 36930802 missense probably damaging 1.00
R3881:Pcdha1 UTSW 18 36931401 missense possibly damaging 0.91
R4012:Pcdha1 UTSW 18 36931136 missense probably benign 0.02
R4540:Pcdha1 UTSW 18 36931627 missense probably damaging 1.00
R4597:Pcdha1 UTSW 18 36931906 missense possibly damaging 0.64
R4678:Pcdha1 UTSW 18 36930912 missense probably benign 0.00
R4998:Pcdha1 UTSW 18 36932416 missense probably damaging 1.00
R5466:Pcdha1 UTSW 18 36932259 missense possibly damaging 0.73
R5518:Pcdha1 UTSW 18 36932362 missense probably benign 0.23
R5673:Pcdha1 UTSW 18 36930673 missense probably damaging 1.00
R5925:Pcdha1 UTSW 18 36930671 missense probably damaging 1.00
R5942:Pcdha1 UTSW 18 36930391 missense probably damaging 1.00
R5963:Pcdha1 UTSW 18 36931171 missense probably damaging 0.99
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6034:Pcdha1 UTSW 18 36930598 missense probably damaging 1.00
R6107:Pcdha1 UTSW 18 36932301 missense probably benign 0.00
R6329:Pcdha1 UTSW 18 36932248 missense probably damaging 1.00
R6479:Pcdha1 UTSW 18 36931456 missense probably benign 0.28
R6503:Pcdha1 UTSW 18 36931671 missense probably damaging 1.00
R7011:Pcdha1 UTSW 18 36930535 missense probably damaging 1.00
R7030:Pcdha1 UTSW 18 37159273 missense probably damaging 0.97
R7314:Pcdha1 UTSW 18 36931500 missense probably damaging 0.99
R7343:Pcdha1 UTSW 18 36930649 missense probably damaging 1.00
R7699:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7700:Pcdha1 UTSW 18 36931062 missense probably damaging 0.98
R7768:Pcdha1 UTSW 18 36932167 missense probably damaging 1.00
R7780:Pcdha1 UTSW 18 36932458 missense probably benign 0.28
R7800:Pcdha1 UTSW 18 36931373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTGAACTGAGAAAATCTTTGG -3'
(R):5'- GGGAGTCCCTTTATCAACTGCC -3'

Sequencing Primer
(F):5'- TCTTTGGATAGAGAAGAAACACCAG -3'
(R):5'- GTCCCTTTATCAACTGCCTTTATTTG -3'
Posted On2018-11-06