Incidental Mutation 'R6908:Mcmdc2'
ID 538845
Institutional Source Beutler Lab
Gene Symbol Mcmdc2
Ensembl Gene ENSMUSG00000046101
Gene Name minichromosome maintenance domain containing 2
Synonyms 6030422M02Rik
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 9978863-10011179 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 10001003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125294] [ENSMUST00000140948] [ENSMUST00000171802]
AlphaFold E9Q956
Predicted Effect probably null
Transcript: ENSMUST00000125294
SMART Domains Protein: ENSMUSP00000120858
Gene: ENSMUSG00000046101

DomainStartEndE-ValueType
Blast:MCM 115 236 3e-73 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000140948
SMART Domains Protein: ENSMUSP00000120577
Gene: ENSMUSG00000046101

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171802
SMART Domains Protein: ENSMUSP00000128620
Gene: ENSMUSG00000046101

DomainStartEndE-ValueType
Pfam:MCM 503 623 1.4e-9 PFAM
low complexity region 658 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183059
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Homozygous knockout mice of both sexes are sterile as a result of abnormal meiosis. This in turn is caused by defective double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Mcmdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02374:Mcmdc2 APN 1 9,982,207 (GRCm39) missense possibly damaging 0.85
IGL03087:Mcmdc2 APN 1 10,001,170 (GRCm39) missense possibly damaging 0.78
IGL03230:Mcmdc2 APN 1 10,002,221 (GRCm39) unclassified probably benign
R0313:Mcmdc2 UTSW 1 10,002,366 (GRCm39) missense probably damaging 1.00
R0448:Mcmdc2 UTSW 1 10,010,767 (GRCm39) makesense probably null
R0685:Mcmdc2 UTSW 1 9,982,039 (GRCm39) critical splice donor site probably null
R0926:Mcmdc2 UTSW 1 9,990,801 (GRCm39) nonsense probably null
R1590:Mcmdc2 UTSW 1 9,986,780 (GRCm39) nonsense probably null
R1867:Mcmdc2 UTSW 1 10,001,030 (GRCm39) missense probably damaging 1.00
R2356:Mcmdc2 UTSW 1 10,001,026 (GRCm39) missense possibly damaging 0.76
R5199:Mcmdc2 UTSW 1 9,990,660 (GRCm39) missense probably benign 0.37
R5341:Mcmdc2 UTSW 1 10,011,142 (GRCm39) frame shift probably null
R5459:Mcmdc2 UTSW 1 10,007,309 (GRCm39) missense probably benign 0.06
R5748:Mcmdc2 UTSW 1 9,982,032 (GRCm39) missense probably damaging 1.00
R6808:Mcmdc2 UTSW 1 10,004,242 (GRCm39) missense probably damaging 1.00
R7123:Mcmdc2 UTSW 1 10,010,643 (GRCm39) missense unknown
R7233:Mcmdc2 UTSW 1 10,002,408 (GRCm39) critical splice donor site probably null
R7498:Mcmdc2 UTSW 1 9,989,302 (GRCm39) missense probably benign
R7646:Mcmdc2 UTSW 1 9,982,360 (GRCm39) missense possibly damaging 0.53
R7834:Mcmdc2 UTSW 1 9,982,399 (GRCm39) critical splice donor site probably null
R8118:Mcmdc2 UTSW 1 9,986,599 (GRCm39) missense possibly damaging 0.68
R8194:Mcmdc2 UTSW 1 9,986,867 (GRCm39) missense probably benign
R8283:Mcmdc2 UTSW 1 10,004,263 (GRCm39) missense possibly damaging 0.85
R8434:Mcmdc2 UTSW 1 9,990,806 (GRCm39) missense possibly damaging 0.63
R8523:Mcmdc2 UTSW 1 9,981,946 (GRCm39) start codon destroyed probably null 0.87
R9244:Mcmdc2 UTSW 1 9,985,835 (GRCm39) missense probably damaging 1.00
R9281:Mcmdc2 UTSW 1 9,994,425 (GRCm39) missense probably damaging 1.00
X0025:Mcmdc2 UTSW 1 9,982,191 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGATAAATCAGCCCACCCTG -3'
(R):5'- CAGAGCCCTTACCATCTGAC -3'

Sequencing Primer
(F):5'- TTCGAGGACAGCATGGTCTAC -3'
(R):5'- GAGCCCTTACCATCTGACCAATC -3'
Posted On 2018-11-06