Incidental Mutation 'R6908:Tyw5'
ID 538846
Institutional Source Beutler Lab
Gene Symbol Tyw5
Ensembl Gene ENSMUSG00000048495
Gene Name tRNA-yW synthesizing protein 5
Synonyms 1110034B05Rik
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 57427394-57445833 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57440682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 27 (R27G)
Ref Sequence ENSEMBL: ENSMUSP00000125427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027114] [ENSMUST00000079998] [ENSMUST00000160118] [ENSMUST00000160837] [ENSMUST00000162686]
AlphaFold A2RSX7
Predicted Effect probably benign
Transcript: ENSMUST00000027114
SMART Domains Protein: ENSMUSP00000027114
Gene: ENSMUSG00000025971

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Blast:Tim44 131 210 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000079998
AA Change: R27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078912
Gene: ENSMUSG00000048495
AA Change: R27G

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 3e-39 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160118
AA Change: R27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125386
Gene: ENSMUSG00000048495
AA Change: R27G

DomainStartEndE-ValueType
PDB:3AL6|D 1 71 1e-38 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160837
AA Change: R21G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128576
Gene: ENSMUSG00000048495
AA Change: R21G

DomainStartEndE-ValueType
JmjC 103 255 2.25e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162686
AA Change: R27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125427
Gene: ENSMUSG00000048495
AA Change: R27G

DomainStartEndE-ValueType
JmjC 105 265 5.8e-3 SMART
Meta Mutation Damage Score 0.1699 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Tyw5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Tyw5 APN 1 57,427,712 (GRCm39) nonsense probably null
IGL01565:Tyw5 APN 1 57,433,240 (GRCm39) missense probably damaging 1.00
IGL01675:Tyw5 APN 1 57,427,791 (GRCm39) missense possibly damaging 0.94
IGL01915:Tyw5 APN 1 57,440,628 (GRCm39) missense probably damaging 0.99
IGL02320:Tyw5 APN 1 57,435,884 (GRCm39) critical splice donor site probably null
IGL02427:Tyw5 APN 1 57,427,884 (GRCm39) missense possibly damaging 0.68
PIT4520001:Tyw5 UTSW 1 57,427,674 (GRCm39) missense probably damaging 1.00
R0053:Tyw5 UTSW 1 57,440,597 (GRCm39) missense probably damaging 0.97
R0053:Tyw5 UTSW 1 57,440,597 (GRCm39) missense probably damaging 0.97
R2421:Tyw5 UTSW 1 57,435,907 (GRCm39) missense possibly damaging 0.58
R2422:Tyw5 UTSW 1 57,435,907 (GRCm39) missense possibly damaging 0.58
R2997:Tyw5 UTSW 1 57,427,800 (GRCm39) missense probably damaging 1.00
R3974:Tyw5 UTSW 1 57,430,687 (GRCm39) missense probably damaging 1.00
R4235:Tyw5 UTSW 1 57,427,647 (GRCm39) utr 3 prime probably benign
R4630:Tyw5 UTSW 1 57,427,686 (GRCm39) missense probably damaging 0.96
R5014:Tyw5 UTSW 1 57,446,004 (GRCm39) start gained probably benign
R5099:Tyw5 UTSW 1 57,427,864 (GRCm39) missense probably damaging 0.99
R5162:Tyw5 UTSW 1 57,440,618 (GRCm39) missense probably damaging 1.00
R6389:Tyw5 UTSW 1 57,430,658 (GRCm39) missense probably damaging 1.00
R6422:Tyw5 UTSW 1 57,440,570 (GRCm39) missense probably damaging 0.99
R6524:Tyw5 UTSW 1 57,427,890 (GRCm39) missense possibly damaging 0.67
R7633:Tyw5 UTSW 1 57,432,644 (GRCm39) missense probably benign 0.01
R7997:Tyw5 UTSW 1 57,427,683 (GRCm39) missense probably benign 0.03
R9218:Tyw5 UTSW 1 57,435,948 (GRCm39) missense probably damaging 0.97
X0018:Tyw5 UTSW 1 57,429,822 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCACAGAACACAGGGTG -3'
(R):5'- TCAAGTAGAGAGGCCATGGC -3'

Sequencing Primer
(F):5'- ACCTGTGGAAAATGTCTCTGTAC -3'
(R):5'- AGAGGCCATGGCAATACTTATGTTG -3'
Posted On 2018-11-06