Incidental Mutation 'R6908:Itgb6'
ID 538849
Institutional Source Beutler Lab
Gene Symbol Itgb6
Ensembl Gene ENSMUSG00000026971
Gene Name integrin beta 6
Synonyms 4831415H04Rik, 2210409C20Rik
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.728) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60428636-60552987 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60480365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 324 (V324M)
Ref Sequence ENSEMBL: ENSMUSP00000117815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]
AlphaFold Q9Z0T9
Predicted Effect probably benign
Transcript: ENSMUST00000028348
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059888
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112517
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.81e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 759 2.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154764
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.62e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 755 2.3e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Itgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Itgb6 APN 2 60,450,696 (GRCm39) missense probably benign 0.07
IGL01363:Itgb6 APN 2 60,441,726 (GRCm39) missense possibly damaging 0.89
IGL01810:Itgb6 APN 2 60,458,329 (GRCm39) missense probably benign 0.19
IGL02026:Itgb6 APN 2 60,458,410 (GRCm39) missense possibly damaging 0.79
IGL02347:Itgb6 APN 2 60,441,756 (GRCm39) missense probably benign
R0372:Itgb6 UTSW 2 60,458,185 (GRCm39) missense probably benign 0.28
R0533:Itgb6 UTSW 2 60,499,541 (GRCm39) missense probably benign 0.22
R0542:Itgb6 UTSW 2 60,435,480 (GRCm39) missense possibly damaging 0.53
R1037:Itgb6 UTSW 2 60,480,412 (GRCm39) missense probably damaging 1.00
R1191:Itgb6 UTSW 2 60,483,481 (GRCm39) splice site probably null
R1775:Itgb6 UTSW 2 60,502,988 (GRCm39) nonsense probably null
R1802:Itgb6 UTSW 2 60,483,625 (GRCm39) missense probably benign 0.22
R1934:Itgb6 UTSW 2 60,499,493 (GRCm39) missense probably benign 0.05
R2847:Itgb6 UTSW 2 60,430,879 (GRCm39) missense probably damaging 1.00
R3934:Itgb6 UTSW 2 60,441,755 (GRCm39) missense possibly damaging 0.89
R5603:Itgb6 UTSW 2 60,450,706 (GRCm39) missense probably benign 0.03
R6255:Itgb6 UTSW 2 60,435,620 (GRCm39) missense probably damaging 1.00
R6571:Itgb6 UTSW 2 60,458,800 (GRCm39) missense probably damaging 1.00
R7010:Itgb6 UTSW 2 60,480,322 (GRCm39) missense probably damaging 1.00
R7212:Itgb6 UTSW 2 60,464,998 (GRCm39) missense probably damaging 0.99
R7259:Itgb6 UTSW 2 60,480,355 (GRCm39) missense probably damaging 1.00
R7300:Itgb6 UTSW 2 60,435,650 (GRCm39) missense probably benign 0.04
R7491:Itgb6 UTSW 2 60,450,720 (GRCm39) missense probably damaging 1.00
R7532:Itgb6 UTSW 2 60,499,557 (GRCm39) missense probably benign
R7861:Itgb6 UTSW 2 60,458,788 (GRCm39) missense probably damaging 1.00
R8086:Itgb6 UTSW 2 60,480,376 (GRCm39) missense probably damaging 0.98
R8795:Itgb6 UTSW 2 60,483,629 (GRCm39) missense probably damaging 1.00
R8886:Itgb6 UTSW 2 60,458,324 (GRCm39) nonsense probably null
R8933:Itgb6 UTSW 2 60,458,247 (GRCm39) missense probably damaging 1.00
R9015:Itgb6 UTSW 2 60,485,032 (GRCm39) missense probably damaging 1.00
R9450:Itgb6 UTSW 2 60,458,372 (GRCm39) missense probably benign
X0018:Itgb6 UTSW 2 60,503,010 (GRCm39) missense possibly damaging 0.88
Z1088:Itgb6 UTSW 2 60,450,555 (GRCm39) missense probably null 1.00
Z1176:Itgb6 UTSW 2 60,441,812 (GRCm39) missense possibly damaging 0.94
Predicted Primers
Posted On 2018-11-06