Incidental Mutation 'R6908:Itgb6'
ID538849
Institutional Source Beutler Lab
Gene Symbol Itgb6
Ensembl Gene ENSMUSG00000026971
Gene Nameintegrin beta 6
Synonyms4831415H04Rik, 2210409C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R6908 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60598292-60722643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60650021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 324 (V324M)
Ref Sequence ENSEMBL: ENSMUSP00000117815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]
Predicted Effect probably benign
Transcript: ENSMUST00000028348
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059888
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112517
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.81e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 759 2.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154764
AA Change: V324M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: V324M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.62e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 755 2.3e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Itgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Itgb6 APN 2 60620352 missense probably benign 0.07
IGL01363:Itgb6 APN 2 60611382 missense possibly damaging 0.89
IGL01810:Itgb6 APN 2 60627985 missense probably benign 0.19
IGL02026:Itgb6 APN 2 60628066 missense possibly damaging 0.79
IGL02347:Itgb6 APN 2 60611412 missense probably benign
R0372:Itgb6 UTSW 2 60627841 missense probably benign 0.28
R0533:Itgb6 UTSW 2 60669197 missense probably benign 0.22
R0542:Itgb6 UTSW 2 60605136 missense possibly damaging 0.53
R1037:Itgb6 UTSW 2 60650068 missense probably damaging 1.00
R1191:Itgb6 UTSW 2 60653137 splice site probably null
R1775:Itgb6 UTSW 2 60672644 nonsense probably null
R1802:Itgb6 UTSW 2 60653281 missense probably benign 0.22
R1934:Itgb6 UTSW 2 60669149 missense probably benign 0.05
R2847:Itgb6 UTSW 2 60600535 missense probably damaging 1.00
R3934:Itgb6 UTSW 2 60611411 missense possibly damaging 0.89
R5603:Itgb6 UTSW 2 60620362 missense probably benign 0.03
R6255:Itgb6 UTSW 2 60605276 missense probably damaging 1.00
R6571:Itgb6 UTSW 2 60628456 missense probably damaging 1.00
R7010:Itgb6 UTSW 2 60649978 missense probably damaging 1.00
R7212:Itgb6 UTSW 2 60634654 missense probably damaging 0.99
R7259:Itgb6 UTSW 2 60650011 missense probably damaging 1.00
R7300:Itgb6 UTSW 2 60605306 missense probably benign 0.04
R7491:Itgb6 UTSW 2 60620376 missense probably damaging 1.00
R7532:Itgb6 UTSW 2 60669213 missense probably benign
R7861:Itgb6 UTSW 2 60628444 missense probably damaging 1.00
R7944:Itgb6 UTSW 2 60628444 missense probably damaging 1.00
R7955:Itgb6 UTSW 2 60649860 intron probably null
X0018:Itgb6 UTSW 2 60672666 missense possibly damaging 0.88
Z1088:Itgb6 UTSW 2 60620211 missense probably null 1.00
Predicted Primers
Posted On2018-11-06