Incidental Mutation 'R6908:Paxip1'
ID 538855
Institutional Source Beutler Lab
Gene Symbol Paxip1
Ensembl Gene ENSMUSG00000002221
Gene Name PAX interacting (with transcription-activation domain) protein 1
Synonyms D5Ertd149e, PTIP
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6908 (G1)
Quality Score 137.008
Status Validated
Chromosome 5
Chromosomal Location 27945078-27996689 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27996222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 19 (Y19C)
Ref Sequence ENSEMBL: ENSMUSP00000142578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002291] [ENSMUST00000196734]
AlphaFold Q6NZQ4
Predicted Effect unknown
Transcript: ENSMUST00000002291
AA Change: Y19C
SMART Domains Protein: ENSMUSP00000002291
Gene: ENSMUSG00000002221
AA Change: Y19C

DomainStartEndE-ValueType
BRCT 10 83 6.72e1 SMART
BRCT 96 173 8.83e-15 SMART
low complexity region 189 208 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
coiled coil region 489 547 N/A INTRINSIC
BRCT 590 671 5.74e-14 SMART
BRCT 690 766 1.67e-15 SMART
BRCT 845 924 4.03e-9 SMART
BRCT 957 1046 3.54e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196734
AA Change: Y19C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142578
Gene: ENSMUSG00000002221
AA Change: Y19C

DomainStartEndE-ValueType
Blast:BRCT 10 83 5e-48 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: This gene encodes a nuclear-localized protein that contains six BRCT1 (C-terminal of breast cancer susceptibility protein) domains. The encoded protein is involved in the repair of DNA double-strand breaks and is necessary for progression through cell division. The protein also functions in the regulation of transcription by recruiting histone methyltransferases to gene promoters bound by the sequence-specific transcription factor paired box protein 2 (Pax2). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice are developmentally retarded and embyronic lethal by E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Paxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Paxip1 APN 5 27,977,550 (GRCm39) utr 3 prime probably benign
IGL01705:Paxip1 APN 5 27,953,857 (GRCm39) missense probably damaging 1.00
IGL01844:Paxip1 APN 5 27,956,036 (GRCm39) missense probably benign 0.17
IGL02143:Paxip1 APN 5 27,980,596 (GRCm39) utr 3 prime probably benign
IGL02863:Paxip1 APN 5 27,964,393 (GRCm39) missense probably benign 0.30
IGL02903:Paxip1 APN 5 27,953,870 (GRCm39) missense probably damaging 1.00
IGL03008:Paxip1 APN 5 27,957,764 (GRCm39) missense probably benign 0.01
BB003:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
BB013:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
R0128:Paxip1 UTSW 5 27,949,183 (GRCm39) splice site probably benign
R0130:Paxip1 UTSW 5 27,949,183 (GRCm39) splice site probably benign
R0331:Paxip1 UTSW 5 27,970,230 (GRCm39) missense probably damaging 0.96
R0357:Paxip1 UTSW 5 27,963,621 (GRCm39) splice site probably benign
R0370:Paxip1 UTSW 5 27,965,084 (GRCm39) missense probably damaging 1.00
R0625:Paxip1 UTSW 5 27,970,940 (GRCm39) nonsense probably null
R1969:Paxip1 UTSW 5 27,949,134 (GRCm39) missense probably damaging 1.00
R2214:Paxip1 UTSW 5 27,947,499 (GRCm39) missense probably damaging 1.00
R3424:Paxip1 UTSW 5 27,980,671 (GRCm39) utr 3 prime probably benign
R3808:Paxip1 UTSW 5 27,977,027 (GRCm39) unclassified probably benign
R3809:Paxip1 UTSW 5 27,977,027 (GRCm39) unclassified probably benign
R3881:Paxip1 UTSW 5 27,953,837 (GRCm39) missense probably damaging 1.00
R3882:Paxip1 UTSW 5 27,953,837 (GRCm39) missense probably damaging 1.00
R4685:Paxip1 UTSW 5 27,966,675 (GRCm39) splice site probably null
R4692:Paxip1 UTSW 5 27,977,095 (GRCm39) unclassified probably benign
R4776:Paxip1 UTSW 5 27,970,204 (GRCm39) missense probably damaging 1.00
R5093:Paxip1 UTSW 5 27,971,282 (GRCm39) missense unknown
R5388:Paxip1 UTSW 5 27,986,453 (GRCm39) utr 3 prime probably benign
R5397:Paxip1 UTSW 5 27,977,002 (GRCm39) unclassified probably benign
R5553:Paxip1 UTSW 5 27,980,637 (GRCm39) utr 3 prime probably benign
R6151:Paxip1 UTSW 5 27,966,616 (GRCm39) missense probably damaging 1.00
R6216:Paxip1 UTSW 5 27,971,171 (GRCm39) missense unknown
R6276:Paxip1 UTSW 5 27,966,666 (GRCm39) missense probably damaging 1.00
R6290:Paxip1 UTSW 5 27,970,576 (GRCm39) splice site probably null
R6584:Paxip1 UTSW 5 27,963,450 (GRCm39) missense probably damaging 0.98
R6688:Paxip1 UTSW 5 27,949,135 (GRCm39) missense probably benign 0.18
R6981:Paxip1 UTSW 5 27,970,766 (GRCm39) nonsense probably null
R7252:Paxip1 UTSW 5 27,965,084 (GRCm39) missense probably damaging 0.96
R7385:Paxip1 UTSW 5 27,986,418 (GRCm39) critical splice donor site probably null
R7585:Paxip1 UTSW 5 27,977,002 (GRCm39) missense unknown
R7665:Paxip1 UTSW 5 27,970,736 (GRCm39) missense unknown
R7926:Paxip1 UTSW 5 27,996,207 (GRCm39) missense unknown
R8169:Paxip1 UTSW 5 27,977,093 (GRCm39) missense unknown
R8335:Paxip1 UTSW 5 27,971,122 (GRCm39) missense unknown
R8732:Paxip1 UTSW 5 27,949,541 (GRCm39) missense probably damaging 1.00
R8790:Paxip1 UTSW 5 27,977,078 (GRCm39) missense unknown
X0066:Paxip1 UTSW 5 27,971,016 (GRCm39) missense unknown
Z1176:Paxip1 UTSW 5 27,988,727 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACCGTGTAAGCAAGGGTAC -3'
(R):5'- TGCCGTACGAACTATTGTAGACC -3'

Sequencing Primer
(F):5'- TTGGCAAGGGACACGCTC -3'
(R):5'- GAACTATTGTAGACCATCAGCACTG -3'
Posted On 2018-11-06