Incidental Mutation 'R6908:Gbp10'
ID 538857
Institutional Source Beutler Lab
Gene Symbol Gbp10
Ensembl Gene ENSMUSG00000105096
Gene Name guanylate-binding protein 10
Synonyms
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 105363565-105387399 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 105368898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 314 (T314P)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
AlphaFold Q000W5
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065588
AA Change: T314P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: T314P

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Gbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Gbp10 APN 5 105,368,980 (GRCm39) splice site probably benign
IGL01680:Gbp10 APN 5 105,372,137 (GRCm39) splice site probably null
IGL01809:Gbp10 APN 5 105,365,225 (GRCm39) missense probably benign
IGL01845:Gbp10 APN 5 105,367,815 (GRCm39) splice site probably null
IGL02011:Gbp10 APN 5 105,368,967 (GRCm39) missense probably damaging 1.00
IGL02063:Gbp10 APN 5 105,383,906 (GRCm39) missense possibly damaging 0.95
IGL02533:Gbp10 APN 5 105,367,901 (GRCm39) missense probably damaging 1.00
IGL02612:Gbp10 APN 5 105,366,368 (GRCm39) missense possibly damaging 0.88
R0349:Gbp10 UTSW 5 105,368,942 (GRCm39) missense possibly damaging 0.60
R0462:Gbp10 UTSW 5 105,366,390 (GRCm39) missense possibly damaging 0.67
R0535:Gbp10 UTSW 5 105,368,877 (GRCm39) missense possibly damaging 0.95
R1223:Gbp10 UTSW 5 105,366,867 (GRCm39) missense probably damaging 1.00
R1704:Gbp10 UTSW 5 105,372,217 (GRCm39) missense probably damaging 1.00
R1792:Gbp10 UTSW 5 105,372,166 (GRCm39) missense probably damaging 1.00
R3738:Gbp10 UTSW 5 105,372,324 (GRCm39) missense possibly damaging 0.84
R3739:Gbp10 UTSW 5 105,372,324 (GRCm39) missense possibly damaging 0.84
R4035:Gbp10 UTSW 5 105,372,324 (GRCm39) missense possibly damaging 0.84
R4421:Gbp10 UTSW 5 105,372,517 (GRCm39) splice site probably null
R5207:Gbp10 UTSW 5 105,372,575 (GRCm39) missense probably benign 0.05
R5338:Gbp10 UTSW 5 105,372,166 (GRCm39) missense probably damaging 1.00
R6010:Gbp10 UTSW 5 105,372,205 (GRCm39) missense probably damaging 1.00
R6045:Gbp10 UTSW 5 105,366,269 (GRCm39) missense probably damaging 0.98
R6156:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R6285:Gbp10 UTSW 5 105,366,326 (GRCm39) missense probably damaging 1.00
R6525:Gbp10 UTSW 5 105,383,950 (GRCm39) missense probably benign 0.01
R7339:Gbp10 UTSW 5 105,367,964 (GRCm39) missense possibly damaging 0.77
R7396:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7397:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7399:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7554:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7555:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7574:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7575:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7576:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7577:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7578:Gbp10 UTSW 5 105,384,015 (GRCm39) start gained probably benign
R7975:Gbp10 UTSW 5 105,368,967 (GRCm39) missense probably benign 0.20
R8293:Gbp10 UTSW 5 105,372,235 (GRCm39) missense probably damaging 1.00
R8708:Gbp10 UTSW 5 105,368,831 (GRCm39) missense probably damaging 1.00
R9002:Gbp10 UTSW 5 105,369,847 (GRCm39) missense probably benign 0.00
R9086:Gbp10 UTSW 5 105,366,369 (GRCm39) missense probably benign 0.00
R9149:Gbp10 UTSW 5 105,366,861 (GRCm39) missense probably damaging 0.98
R9402:Gbp10 UTSW 5 105,381,863 (GRCm39) missense possibly damaging 0.82
R9582:Gbp10 UTSW 5 105,372,256 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGAATGCTCCATGAAGACAGC -3'
(R):5'- TGATAGCTTGCTGAAGGAGG -3'

Sequencing Primer
(F):5'- AGACAGCCATGGCTTCCTTC -3'
(R):5'- ATAGCTTGCTGAAGGAGGTTTTG -3'
Posted On 2018-11-06