Incidental Mutation 'R6908:Kdm7a'
ID538859
Institutional Source Beutler Lab
Gene Symbol Kdm7a
Ensembl Gene ENSMUSG00000042599
Gene Namelysine (K)-specific demethylase 7A
SynonymsKdm7a, Jhdm1d, ENSMUSG00000073143, A630082K20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6908 (G1)
Quality Score190.009
Status Validated
Chromosome6
Chromosomal Location39136623-39206789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39144439 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 861 (L861M)
Ref Sequence ENSEMBL: ENSMUSP00000002305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002305]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002305
AA Change: L861M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002305
Gene: ENSMUSG00000042599
AA Change: L861M

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
PHD 39 86 8.64e-9 SMART
low complexity region 186 197 N/A INTRINSIC
JmjC 230 386 1.09e-49 SMART
low complexity region 408 419 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicle, tail, sebaceous gland, rib, and vertebrae morphology and decreased circulating iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Kdm7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kdm7a APN 6 39144510 missense probably benign
IGL00976:Kdm7a APN 6 39144398 missense possibly damaging 0.90
IGL01063:Kdm7a APN 6 39165130 missense probably damaging 0.98
IGL01325:Kdm7a APN 6 39158309 splice site probably benign
IGL01710:Kdm7a APN 6 39175386 missense probably benign 0.06
IGL01953:Kdm7a APN 6 39146902 missense probably benign 0.10
IGL02336:Kdm7a APN 6 39170264 missense probably damaging 1.00
IGL02721:Kdm7a APN 6 39173437 missense possibly damaging 0.93
IGL02963:Kdm7a APN 6 39143230 missense probably damaging 1.00
IGL03165:Kdm7a APN 6 39170914 splice site probably benign
R0033:Kdm7a UTSW 6 39165197 nonsense probably null
R0831:Kdm7a UTSW 6 39166765 splice site probably benign
R0920:Kdm7a UTSW 6 39151322 missense probably damaging 1.00
R0962:Kdm7a UTSW 6 39147194 missense probably benign 0.05
R1403:Kdm7a UTSW 6 39151253 splice site probably benign
R1632:Kdm7a UTSW 6 39152898 missense probably benign 0.15
R1759:Kdm7a UTSW 6 39147699 splice site probably null
R2143:Kdm7a UTSW 6 39168950 missense possibly damaging 0.61
R2197:Kdm7a UTSW 6 39146936 missense probably damaging 0.98
R2496:Kdm7a UTSW 6 39170763 splice site probably null
R3844:Kdm7a UTSW 6 39181579 missense probably damaging 1.00
R4083:Kdm7a UTSW 6 39152814 missense probably damaging 1.00
R4184:Kdm7a UTSW 6 39148977 missense probably benign
R4193:Kdm7a UTSW 6 39169096 missense probably damaging 1.00
R4402:Kdm7a UTSW 6 39166668 missense probably null 1.00
R4544:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4546:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4560:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4561:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4562:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4563:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4737:Kdm7a UTSW 6 39152839 missense possibly damaging 0.57
R5061:Kdm7a UTSW 6 39151452 missense possibly damaging 0.88
R5247:Kdm7a UTSW 6 39144456 missense probably benign 0.00
R5430:Kdm7a UTSW 6 39149342 missense possibly damaging 0.85
R6248:Kdm7a UTSW 6 39147049 missense possibly damaging 0.63
R6254:Kdm7a UTSW 6 39170269 missense probably damaging 1.00
R6346:Kdm7a UTSW 6 39151211 intron probably null
R6420:Kdm7a UTSW 6 39165168 missense probably damaging 1.00
R6966:Kdm7a UTSW 6 39152839 missense probably damaging 1.00
R7048:Kdm7a UTSW 6 39169048 missense probably damaging 1.00
R7087:Kdm7a UTSW 6 39175381 missense probably benign 0.18
R7450:Kdm7a UTSW 6 39143251 missense probably damaging 1.00
R7737:Kdm7a UTSW 6 39144404 missense probably benign 0.03
RF012:Kdm7a UTSW 6 39206513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGTGTCCCCACCTACTAC -3'
(R):5'- ATGCAGAGAAAGCTTTAAATACCTC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GTAGAAGCCAGAAACACATC -3'
Posted On2018-11-06