Incidental Mutation 'R6908:Ints13'
ID 538860
Institutional Source Beutler Lab
Gene Symbol Ints13
Ensembl Gene ENSMUSG00000040250
Gene Name integrator complex subunit 13
Synonyms Spata30, 4933424B01Rik, Asun
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 146549632-146577835 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 146555033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 438 (D438E)
Ref Sequence ENSEMBL: ENSMUSP00000032427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032427] [ENSMUST00000203545]
AlphaFold Q8QZV7
Predicted Effect probably damaging
Transcript: ENSMUST00000032427
AA Change: D438E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032427
Gene: ENSMUSG00000040250
AA Change: D438E

DomainStartEndE-ValueType
Pfam:DUF2151 4 692 8.2e-292 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118000
Gene: ENSMUSG00000040250
AA Change: D385E

DomainStartEndE-ValueType
Pfam:DUF2151 1 394 7.2e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139979
SMART Domains Protein: ENSMUSP00000122279
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 2 216 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203545
SMART Domains Protein: ENSMUSP00000145229
Gene: ENSMUSG00000040250

DomainStartEndE-ValueType
Pfam:DUF2151 1 96 3.8e-48 PFAM
Pfam:DUF2151 94 313 6e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Ints13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ints13 APN 6 146565676 missense probably damaging 1.00
IGL02085:Ints13 APN 6 146549939 utr 3 prime probably benign
IGL02439:Ints13 APN 6 146554223 splice site probably benign
IGL02512:Ints13 APN 6 146576357 missense probably damaging 1.00
IGL02523:Ints13 APN 6 146557611 missense probably benign 0.09
IGL02988:Ints13 APN 6 146556148 missense possibly damaging 0.49
R0083:Ints13 UTSW 6 146550664 missense probably benign 0.06
R0085:Ints13 UTSW 6 146574787 splice site probably benign
R0184:Ints13 UTSW 6 146555044 missense probably benign 0.26
R0656:Ints13 UTSW 6 146552461 missense probably benign 0.19
R1808:Ints13 UTSW 6 146554197 missense probably damaging 1.00
R1838:Ints13 UTSW 6 146566611 missense possibly damaging 0.92
R1906:Ints13 UTSW 6 146552370 critical splice donor site probably null
R2140:Ints13 UTSW 6 146576431 missense probably damaging 1.00
R3082:Ints13 UTSW 6 146574707 missense possibly damaging 0.92
R5568:Ints13 UTSW 6 146576357 missense probably damaging 1.00
R5757:Ints13 UTSW 6 146550106 missense probably benign 0.01
R5770:Ints13 UTSW 6 146555073 missense probably damaging 0.98
R5809:Ints13 UTSW 6 146576349 missense probably benign 0.06
R6273:Ints13 UTSW 6 146565681 missense probably damaging 1.00
R6882:Ints13 UTSW 6 146563441 missense probably null 0.18
R7089:Ints13 UTSW 6 146574718 missense probably damaging 1.00
R7425:Ints13 UTSW 6 146574700 critical splice donor site probably null
R7660:Ints13 UTSW 6 146557338 missense probably benign 0.24
R7957:Ints13 UTSW 6 146550766 missense probably damaging 0.99
R8529:Ints13 UTSW 6 146563428 missense probably damaging 0.98
R8847:Ints13 UTSW 6 146556133 missense probably benign 0.01
R9368:Ints13 UTSW 6 146565631 missense probably null 0.99
R9703:Ints13 UTSW 6 146557565 missense probably damaging 1.00
R9777:Ints13 UTSW 6 146561828 missense probably damaging 0.99
RF011:Ints13 UTSW 6 146556240 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACACCATAACTGCTGCTTCTG -3'
(R):5'- AGAGAAAGGGCTTTGCTGGC -3'

Sequencing Primer
(F):5'- CTTGCTTGAGAAATGGCACC -3'
(R):5'- TTTGCTGGCAGTCACAGGAC -3'
Posted On 2018-11-06