Incidental Mutation 'R6908:Lypd3'
ID 538861
Institutional Source Beutler Lab
Gene Symbol Lypd3
Ensembl Gene ENSMUSG00000057454
Gene Name Ly6/Plaur domain containing 3
Synonyms 2310061G07Rik, C4.4A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 24636550-24641118 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 24638433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 75 (G75R)
Ref Sequence ENSEMBL: ENSMUSP00000079543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080718]
AlphaFold Q91YK8
Predicted Effect probably damaging
Transcript: ENSMUST00000080718
AA Change: G75R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079543
Gene: ENSMUSG00000057454
AA Change: G75R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LU 33 128 7.26e-26 SMART
Pfam:UPAR_LY6 142 224 1.3e-16 PFAM
low complexity region 234 255 N/A INTRINSIC
low complexity region 258 278 N/A INTRINSIC
low complexity region 303 320 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Homozygous null mice show no overt epidermal phenotype and have normal squamous epithelia morphology but are lighter and leaner than controls. Males display delayed wound healing whereas females show reduced food intake and a lower incidence of invasive lesions in a BBN-induced bladder cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Lypd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lypd3 APN 7 24640593 missense probably benign 0.00
IGL01443:Lypd3 APN 7 24636638 missense probably benign 0.03
R0200:Lypd3 UTSW 7 24640231 missense probably damaging 1.00
R0726:Lypd3 UTSW 7 24638544 nonsense probably null
R1706:Lypd3 UTSW 7 24640330 missense probably benign 0.00
R5714:Lypd3 UTSW 7 24639069 missense possibly damaging 0.86
R5771:Lypd3 UTSW 7 24640362 missense probably benign
R6137:Lypd3 UTSW 7 24640494 missense probably benign 0.00
R6932:Lypd3 UTSW 7 24638433 missense probably damaging 1.00
R6935:Lypd3 UTSW 7 24638433 missense probably damaging 1.00
R7632:Lypd3 UTSW 7 24638440 missense possibly damaging 0.60
R8769:Lypd3 UTSW 7 24638507 missense probably damaging 0.99
R9663:Lypd3 UTSW 7 24638924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTTCTCGTTGGACTG -3'
(R):5'- GATGTCTGCAGTCTTCAACCC -3'

Sequencing Primer
(F):5'- GGACTGTATTCTTTGAAGCTCTTC -3'
(R):5'- TAGCTCCCAGCCCTAGTGTG -3'
Posted On 2018-11-06