Incidental Mutation 'R6908:Hbb-bs'
ID 538862
Institutional Source Beutler Lab
Gene Symbol Hbb-bs
Ensembl Gene ENSMUSG00000052305
Gene Name hemoglobin, beta adult s chain
Synonyms beta s
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock # R6908 (G1)
Quality Score 113.008
Status Not validated
Chromosome 7
Chromosomal Location 103826534-103828096 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103827534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 77 (N77D)
Ref Sequence ENSEMBL: ENSMUSP00000115607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023934] [ENSMUST00000153218]
AlphaFold A8DUK4
Predicted Effect probably benign
Transcript: ENSMUST00000023934
AA Change: N77D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023934
Gene: ENSMUSG00000052305
AA Change: N77D

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153218
AA Change: N77D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115607
Gene: ENSMUSG00000052305
AA Change: N77D

DomainStartEndE-ValueType
Pfam:Globin 8 103 3.8e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta s adult gene found in the "single" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Hbb-bs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Hbb-bs APN 7 103827884 splice site probably benign
IGL03120:Hbb-bs APN 7 103827778 splice site probably benign
R0219:Hbb-bs UTSW 7 103826669 missense possibly damaging 0.78
R2243:Hbb-bs UTSW 7 103827811 missense possibly damaging 0.51
R4297:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R4921:Hbb-bs UTSW 7 103826720 missense probably damaging 0.98
R5802:Hbb-bs UTSW 7 103826672 missense probably damaging 1.00
R8350:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R8450:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R8509:Hbb-bs UTSW 7 103826712 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACTGCTCCCTAGAATCGC -3'
(R):5'- CACAAGAAGTTGGGTGCTTGG -3'

Sequencing Primer
(F):5'- GCTCCCTAGAATCGCTTCCC -3'
(R):5'- CAGCAGGCACTAACTTTGAGTGTC -3'
Posted On 2018-11-06