Incidental Mutation 'R6908:Olfr710'
ID 538863
Institutional Source Beutler Lab
Gene Symbol Olfr710
Ensembl Gene ENSMUSG00000045581
Gene Name olfactory receptor 710
Synonyms GA_x6K02T2PBJ9-9325348-9324416, MOR260-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106943911-106948312 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106944632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 123 (Y123C)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
AlphaFold Q9EP55
Predicted Effect possibly damaging
Transcript: ENSMUST00000055923
AA Change: Y123C

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: Y123C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Olfr710
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr710 APN 7 106944541 missense possibly damaging 0.77
IGL01534:Olfr710 APN 7 106944339 missense probably damaging 1.00
IGL02041:Olfr710 APN 7 106944113 missense possibly damaging 0.78
IGL02414:Olfr710 APN 7 106944758 missense probably benign 0.33
IGL02695:Olfr710 APN 7 106944663 missense possibly damaging 0.93
IGL03167:Olfr710 APN 7 106944645 missense probably damaging 0.99
IGL03242:Olfr710 APN 7 106944918 missense possibly damaging 0.59
R1985:Olfr710 UTSW 7 106944926 missense probably benign 0.00
R2234:Olfr710 UTSW 7 106944620 missense probably damaging 1.00
R3414:Olfr710 UTSW 7 106944176 nonsense probably null
R3731:Olfr710 UTSW 7 106944477 missense probably damaging 0.99
R3777:Olfr710 UTSW 7 106944312 missense probably benign 0.05
R4646:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4647:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4661:Olfr710 UTSW 7 106944867 missense probably damaging 0.98
R4679:Olfr710 UTSW 7 106944945 missense probably benign 0.10
R5200:Olfr710 UTSW 7 106944980 missense possibly damaging 0.77
R5495:Olfr710 UTSW 7 106944492 nonsense probably null
R6744:Olfr710 UTSW 7 106944534 missense probably damaging 1.00
R7463:Olfr710 UTSW 7 106944173 missense probably damaging 0.99
R7498:Olfr710 UTSW 7 106944368 missense possibly damaging 0.93
R8686:Olfr710 UTSW 7 106944698 missense probably benign 0.01
R9283:Olfr710 UTSW 7 106944599 missense probably benign 0.01
RF003:Olfr710 UTSW 7 106944648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAGTGCAGGAGGCTCAC -3'
(R):5'- ATGTTGACTCCCGACTTCATAC -3'

Sequencing Primer
(F):5'- CAGGAGGCTCACAAAAGTAATGATTG -3'
(R):5'- CGACTTCATACACCAATGTACTTC -3'
Posted On 2018-11-06