Incidental Mutation 'R6908:Or2d4'
ID 538863
Institutional Source Beutler Lab
Gene Symbol Or2d4
Ensembl Gene ENSMUSG00000045581
Gene Name olfactory receptor family 2 subfamily D member 4
Synonyms MOR260-3, Olfr710, GA_x6K02T2PBJ9-9325348-9324416
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106543274-106547519 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106543839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 123 (Y123C)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
AlphaFold Q9EP55
Predicted Effect possibly damaging
Transcript: ENSMUST00000055923
AA Change: Y123C

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: Y123C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Or2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Or2d4 APN 7 106,543,748 (GRCm39) missense possibly damaging 0.77
IGL01534:Or2d4 APN 7 106,543,546 (GRCm39) missense probably damaging 1.00
IGL02041:Or2d4 APN 7 106,543,320 (GRCm39) missense possibly damaging 0.78
IGL02414:Or2d4 APN 7 106,543,965 (GRCm39) missense probably benign 0.33
IGL02695:Or2d4 APN 7 106,543,870 (GRCm39) missense possibly damaging 0.93
IGL03167:Or2d4 APN 7 106,543,852 (GRCm39) missense probably damaging 0.99
IGL03242:Or2d4 APN 7 106,544,125 (GRCm39) missense possibly damaging 0.59
R1985:Or2d4 UTSW 7 106,544,133 (GRCm39) missense probably benign 0.00
R2234:Or2d4 UTSW 7 106,543,827 (GRCm39) missense probably damaging 1.00
R3414:Or2d4 UTSW 7 106,543,383 (GRCm39) nonsense probably null
R3731:Or2d4 UTSW 7 106,543,684 (GRCm39) missense probably damaging 0.99
R3777:Or2d4 UTSW 7 106,543,519 (GRCm39) missense probably benign 0.05
R4646:Or2d4 UTSW 7 106,543,547 (GRCm39) missense probably benign 0.01
R4647:Or2d4 UTSW 7 106,543,547 (GRCm39) missense probably benign 0.01
R4661:Or2d4 UTSW 7 106,544,074 (GRCm39) missense probably damaging 0.98
R4679:Or2d4 UTSW 7 106,544,152 (GRCm39) missense probably benign 0.10
R5200:Or2d4 UTSW 7 106,544,187 (GRCm39) missense possibly damaging 0.77
R5495:Or2d4 UTSW 7 106,543,699 (GRCm39) nonsense probably null
R6744:Or2d4 UTSW 7 106,543,741 (GRCm39) missense probably damaging 1.00
R7463:Or2d4 UTSW 7 106,543,380 (GRCm39) missense probably damaging 0.99
R7498:Or2d4 UTSW 7 106,543,575 (GRCm39) missense possibly damaging 0.93
R8686:Or2d4 UTSW 7 106,543,905 (GRCm39) missense probably benign 0.01
R9283:Or2d4 UTSW 7 106,543,806 (GRCm39) missense probably benign 0.01
RF003:Or2d4 UTSW 7 106,543,855 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAGTGCAGGAGGCTCAC -3'
(R):5'- ATGTTGACTCCCGACTTCATAC -3'

Sequencing Primer
(F):5'- CAGGAGGCTCACAAAAGTAATGATTG -3'
(R):5'- CGACTTCATACACCAATGTACTTC -3'
Posted On 2018-11-06