Mutagenetix > Incidental Mutation

Incidental Mutation 'R6908:Atp2a1'

538864

Institutional Source

Beutler Lab

Gene Symbol

Atp2a1

Ensembl Gene

ENSMUSG00000030730

Gene Name

ATPase, Ca++ transporting, cardiac muscle, fast twitch 1

Synonyms

SERCA1

MMRRC Submission

Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126445858-126463108 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 126448535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]

AlphaFold

Q8R429

Predicted Effect

probably null
Transcript: ENSMUST00000032974

SMART Domains

Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730

Domain	Start	End	E-Value	Type
Cation_ATPase_N	3	77	4.39e-16	SMART
Pfam:E1-E2_ATPase	92	340	1.5e-66	PFAM
Pfam:Hydrolase	345	715	7.5e-20	PFAM
Pfam:HAD	348	712	1.2e-18	PFAM
Pfam:Cation_ATPase	418	528	3.2e-23	PFAM
Pfam:Hydrolase_3	683	747	2.3e-7	PFAM
Pfam:Cation_ATPase_C	784	987	4.8e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106405

SMART Domains

Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727

Domain	Start	End	E-Value	Type
Pfam:Rabaptin	2	107	1.4e-41	PFAM
low complexity region	139	158	N/A	INTRINSIC
low complexity region	175	194	N/A	INTRINSIC
Pfam:Rabaptin	196	311	5.9e-10	PFAM
Pfam:Rab5-bind	289	456	4.6e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106407

SMART Domains

Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727

Domain	Start	End	E-Value	Type
Pfam:Rabaptin	13	171	1.4e-39	PFAM
low complexity region	182	201	N/A	INTRINSIC
low complexity region	218	237	N/A	INTRINSIC
Pfam:Rab5-bind	274	487	4.1e-21	PFAM
Pfam:Rab5-bind	469	531	1.6e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146973

SMART Domains

Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730

Domain	Start	End	E-Value	Type
Pfam:Cation_ATPase_C	6	132	6.3e-21	PFAM

Meta Mutation Damage Score

0.9500

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Atp2a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Atp2a1	APN	7	126447216	nonsense	probably null
IGL00474:Atp2a1	APN	7	126450294	nonsense	probably null
IGL00500:Atp2a1	APN	7	126447216	nonsense	probably null
IGL01112:Atp2a1	APN	7	126450307	missense	probably benign	0.13
IGL01380:Atp2a1	APN	7	126448770	missense	possibly damaging	0.84
IGL01503:Atp2a1	APN	7	126448578	missense	probably damaging	1.00
IGL01630:Atp2a1	APN	7	126450265	missense	probably benign	0.00
IGL01679:Atp2a1	APN	7	126456809	missense	probably benign	0.00
IGL01729:Atp2a1	APN	7	126457934	missense	probably damaging	0.99
IGL02290:Atp2a1	APN	7	126452649	splice site	probably benign
IGL02929:Atp2a1	APN	7	126456944	missense	probably damaging	1.00
IGL02951:Atp2a1	APN	7	126450227	missense	possibly damaging	0.58
IGL03249:Atp2a1	APN	7	126462805	missense	probably benign	0.12
1mM(1):Atp2a1	UTSW	7	126446909	missense	probably damaging	1.00
R0052:Atp2a1	UTSW	7	126457897	splice site	probably benign
R0052:Atp2a1	UTSW	7	126457897	splice site	probably benign
R0070:Atp2a1	UTSW	7	126447452	missense	probably benign	0.03
R0070:Atp2a1	UTSW	7	126447452	missense	probably benign	0.03
R0121:Atp2a1	UTSW	7	126457944	missense	probably damaging	1.00
R0398:Atp2a1	UTSW	7	126450418	unclassified	probably benign
R0578:Atp2a1	UTSW	7	126450143	missense	probably benign
R0626:Atp2a1	UTSW	7	126446990	critical splice acceptor site	probably null
R0739:Atp2a1	UTSW	7	126448256	missense	possibly damaging	0.87
R1558:Atp2a1	UTSW	7	126452672	missense	possibly damaging	0.88
R1700:Atp2a1	UTSW	7	126462909	missense	probably damaging	1.00
R1748:Atp2a1	UTSW	7	126459608	missense	possibly damaging	0.67
R1799:Atp2a1	UTSW	7	126450142	missense	probably benign	0.27
R1808:Atp2a1	UTSW	7	126453401	missense	probably damaging	0.97
R2058:Atp2a1	UTSW	7	126447672	missense	possibly damaging	0.60
R2143:Atp2a1	UTSW	7	126448725	nonsense	probably null
R2427:Atp2a1	UTSW	7	126446583	makesense	probably null
R3113:Atp2a1	UTSW	7	126448369	missense	probably damaging	1.00
R4501:Atp2a1	UTSW	7	126453383	missense	probably benign	0.00
R4604:Atp2a1	UTSW	7	126448623	missense	probably damaging	0.96
R4934:Atp2a1	UTSW	7	126453428	missense	probably benign
R4939:Atp2a1	UTSW	7	126450116	missense	probably benign
R5646:Atp2a1	UTSW	7	126453105	missense	probably benign
R6093:Atp2a1	UTSW	7	126446921	missense	probably damaging	1.00
R6556:Atp2a1	UTSW	7	126450262	missense	probably benign	0.37
R6911:Atp2a1	UTSW	7	126456836	missense	probably damaging	1.00
R7206:Atp2a1	UTSW	7	126447972	missense	probably benign	0.01
R7354:Atp2a1	UTSW	7	126448856	missense	probably damaging	1.00
R7363:Atp2a1	UTSW	7	126462889	missense	possibly damaging	0.88
R7501:Atp2a1	UTSW	7	126450172	missense	probably benign	0.29
R7560:Atp2a1	UTSW	7	126459656	missense	possibly damaging	0.95
R7716:Atp2a1	UTSW	7	126462187	missense	possibly damaging	0.86
R7772:Atp2a1	UTSW	7	126448535	critical splice donor site	probably null
R8039:Atp2a1	UTSW	7	126448805	missense	probably damaging	0.99
R8391:Atp2a1	UTSW	7	126448716	missense	possibly damaging	0.94
R8478:Atp2a1	UTSW	7	126448330	missense	probably damaging	1.00
R9020:Atp2a1	UTSW	7	126446963	missense	probably benign
X0022:Atp2a1	UTSW	7	126448250	missense	possibly damaging	0.49
X0060:Atp2a1	UTSW	7	126462882	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- AGCAGGGGCATCATTGACAC -3'
(R):5'- AAGGGTACAGCCATTGCCATC -3'

Sequencing Primer
(F):5'- GGGGCATCATTGACACCATCC -3'
(R):5'- ATTGCCATCTGCCGACGAATTG -3'

Posted On

2018-11-06