Mutagenetix > Incidental Mutation

Incidental Mutation 'R6908:Mcf2l'

538865

Institutional Source

Beutler Lab

Gene Symbol

Mcf2l

Ensembl Gene

ENSMUSG00000031442

Gene Name

mcf.2 transforming sequence-like

Synonyms

C130040G20Rik, Dbs

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12873806-13020905 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13018919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1087 (V1087A)

Ref Sequence

ENSEMBL: ENSMUSP00000106491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173099]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000095456

SMART Domains

Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	75	221	1.77e-24	SMART
SPEC	354	455	4.41e-15	SMART
coiled coil region	507	529	N/A	INTRINSIC
low complexity region	578	594	N/A	INTRINSIC
RhoGEF	636	811	2.83e-63	SMART
PH	831	948	8.13e-14	SMART
low complexity region	966	978	N/A	INTRINSIC
SH3	1058	1115	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098927

SMART Domains

Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	49	195	1.77e-24	SMART
SPEC	328	429	4.41e-15	SMART
coiled coil region	481	503	N/A	INTRINSIC
low complexity region	552	568	N/A	INTRINSIC
RhoGEF	610	785	2.83e-63	SMART
PH	805	922	8.13e-14	SMART
low complexity region	940	952	N/A	INTRINSIC
low complexity region	1022	1033	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110866

SMART Domains

Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	23	169	1.77e-24	SMART
SPEC	302	403	4.41e-15	SMART
coiled coil region	455	477	N/A	INTRINSIC
low complexity region	526	542	N/A	INTRINSIC
RhoGEF	584	759	2.83e-63	SMART
PH	779	896	8.13e-14	SMART
low complexity region	914	926	N/A	INTRINSIC
SH3	1006	1063	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110867
AA Change: V1087A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442
AA Change: V1087A

Domain	Start	End	E-Value	Type
SEC14	23	169	1.77e-24	SMART
SPEC	302	403	4.41e-15	SMART
coiled coil region	455	477	N/A	INTRINSIC
low complexity region	526	542	N/A	INTRINSIC
RhoGEF	584	759	2.83e-63	SMART
PH	779	896	8.13e-14	SMART
low complexity region	914	926	N/A	INTRINSIC
SH3	1006	1063	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110871

SMART Domains

Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SEC14	43	189	1.77e-24	SMART
SPEC	322	423	4.41e-15	SMART
coiled coil region	475	497	N/A	INTRINSIC
low complexity region	546	562	N/A	INTRINSIC
RhoGEF	604	779	2.83e-63	SMART
PH	799	916	8.13e-14	SMART
low complexity region	934	946	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110873

SMART Domains

Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SPEC	165	266	4.41e-15	SMART
coiled coil region	318	340	N/A	INTRINSIC
low complexity region	389	405	N/A	INTRINSIC
RhoGEF	447	622	2.83e-63	SMART
PH	642	759	8.13e-14	SMART
low complexity region	777	789	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110876

SMART Domains

Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	45	191	1.77e-24	SMART
SPEC	324	425	4.41e-15	SMART
coiled coil region	477	499	N/A	INTRINSIC
low complexity region	548	564	N/A	INTRINSIC
RhoGEF	606	781	2.83e-63	SMART
PH	801	918	8.13e-14	SMART
low complexity region	936	948	N/A	INTRINSIC
SH3	1084	1141	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110879

SMART Domains

Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	45	191	1.77e-24	SMART
SPEC	324	425	4.41e-15	SMART
coiled coil region	477	499	N/A	INTRINSIC
low complexity region	548	564	N/A	INTRINSIC
RhoGEF	606	781	2.83e-63	SMART
PH	801	918	8.13e-14	SMART
low complexity region	936	948	N/A	INTRINSIC
SH3	1028	1085	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123811

SMART Domains

Protein: ENSMUSP00000123434
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
PH	1	88	6.67e-1	SMART
low complexity region	106	118	N/A	INTRINSIC
SH3	198	255	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126905

SMART Domains

Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SPEC	5	88	8.25e-6	SMART
coiled coil region	139	161	N/A	INTRINSIC
low complexity region	211	227	N/A	INTRINSIC
RhoGEF	269	444	2.83e-63	SMART
PH	464	581	8.13e-14	SMART
low complexity region	599	611	N/A	INTRINSIC
SH3	716	773	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134227

SMART Domains

Protein: ENSMUSP00000116731
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
Pfam:PH	1	81	1.5e-7	PFAM
low complexity region	101	113	N/A	INTRINSIC
low complexity region	236	247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139776

SMART Domains

Protein: ENSMUSP00000120946
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SH3	99	156	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145067

SMART Domains

Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
Pfam:CRAL_TRIO_2	16	132	2.4e-12	PFAM
SPEC	261	362	4.41e-15	SMART
coiled coil region	414	436	N/A	INTRINSIC
low complexity region	485	501	N/A	INTRINSIC
RhoGEF	543	718	2.83e-63	SMART
PH	738	855	8.13e-14	SMART
low complexity region	873	885	N/A	INTRINSIC
SH3	1021	1078	3.33e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145892

SMART Domains

Protein: ENSMUSP00000114758
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
Blast:PH	2	23	1e-6	BLAST
PDB:1KZG\|C	2	40	1e-19	PDB
SCOP:d1kz7a2	2	40	6e-7	SMART
low complexity region	41	53	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173099

SMART Domains

Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	41	187	1.77e-24	SMART
SPEC	320	421	4.41e-15	SMART
coiled coil region	473	495	N/A	INTRINSIC
low complexity region	544	560	N/A	INTRINSIC
RhoGEF	602	777	2.83e-63	SMART
PH	797	914	8.13e-14	SMART
low complexity region	932	944	N/A	INTRINSIC
low complexity region	1014	1025	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Mcf2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Mcf2l	APN	8	13000857	missense	probably damaging	0.98
IGL00426:Mcf2l	APN	8	12984910	missense	probably damaging	1.00
IGL01391:Mcf2l	APN	8	13014010	splice site	probably null
IGL01795:Mcf2l	APN	8	13000749	splice site	probably null
IGL02314:Mcf2l	APN	8	13001851	missense	probably damaging	0.99
IGL02716:Mcf2l	APN	8	12997277	missense	probably benign	0.19
IGL02985:Mcf2l	APN	8	12963239	missense	probably damaging	1.00
IGL03073:Mcf2l	APN	8	13000004	missense	probably damaging	1.00
IGL03308:Mcf2l	APN	8	13009512	missense	probably damaging	1.00
IGL03371:Mcf2l	APN	8	13001298	missense	probably damaging	1.00
P0022:Mcf2l	UTSW	8	13018897	nonsense	probably null
R0062:Mcf2l	UTSW	8	13006766	unclassified	probably benign
R0067:Mcf2l	UTSW	8	13013060	missense	probably benign	0.01
R0110:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0450:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0469:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0510:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0543:Mcf2l	UTSW	8	12996728	critical splice donor site	probably null
R0591:Mcf2l	UTSW	8	13018751	missense	probably benign	0.11
R0801:Mcf2l	UTSW	8	13014020	intron	probably benign
R0962:Mcf2l	UTSW	8	13001964	missense	probably benign	0.14
R1084:Mcf2l	UTSW	8	13002645	missense	possibly damaging	0.94
R1794:Mcf2l	UTSW	8	12915982	missense	probably benign	0.33
R2111:Mcf2l	UTSW	8	13001867	missense	probably damaging	0.99
R2112:Mcf2l	UTSW	8	13001867	missense	probably damaging	0.99
R3785:Mcf2l	UTSW	8	12880099	missense	probably damaging	0.97
R4777:Mcf2l	UTSW	8	13018051	splice site	probably null
R4858:Mcf2l	UTSW	8	13013972	missense	probably damaging	1.00
R4980:Mcf2l	UTSW	8	12984883	missense	probably damaging	1.00
R5021:Mcf2l	UTSW	8	13011808	missense	probably damaging	1.00
R5067:Mcf2l	UTSW	8	12915959	intron	probably benign
R5158:Mcf2l	UTSW	8	13009715	missense	probably damaging	1.00
R5439:Mcf2l	UTSW	8	12926646	missense	possibly damaging	0.85
R5569:Mcf2l	UTSW	8	13005481	missense	probably damaging	1.00
R5655:Mcf2l	UTSW	8	13010444	missense	probably damaging	0.98
R5668:Mcf2l	UTSW	8	13013812	nonsense	probably null
R5753:Mcf2l	UTSW	8	12999993	missense	probably damaging	1.00
R5808:Mcf2l	UTSW	8	12993937	start codon destroyed	probably null	0.92
R5946:Mcf2l	UTSW	8	13013922	missense	probably damaging	1.00
R6168:Mcf2l	UTSW	8	13001823	missense	probably benign	0.05
R6174:Mcf2l	UTSW	8	13013849	nonsense	probably null
R6212:Mcf2l	UTSW	8	13017431	missense	probably damaging	1.00
R6270:Mcf2l	UTSW	8	13018701	missense	probably damaging	0.99
R6383:Mcf2l	UTSW	8	12879912	start gained	probably benign
R6850:Mcf2l	UTSW	8	13009476	missense	possibly damaging	0.82
R7101:Mcf2l	UTSW	8	13013579	missense	possibly damaging	0.80
R7163:Mcf2l	UTSW	8	12915439	missense	probably benign	0.00
R7203:Mcf2l	UTSW	8	13010456	missense	probably benign	0.09
R7414:Mcf2l	UTSW	8	13019022	makesense	probably null
R7553:Mcf2l	UTSW	8	12997268	missense	probably benign
R7556:Mcf2l	UTSW	8	12973071	missense	probably damaging	0.99
R7688:Mcf2l	UTSW	8	12948130	missense	possibly damaging	0.74
R7776:Mcf2l	UTSW	8	12880127	missense	probably benign
R7947:Mcf2l	UTSW	8	13003529	splice site	probably null
R8077:Mcf2l	UTSW	8	12998494	critical splice donor site	probably null
R8083:Mcf2l	UTSW	8	13007875	splice site	probably null
R8133:Mcf2l	UTSW	8	13011487	missense	probably damaging	1.00
R8189:Mcf2l	UTSW	8	12963164	missense	probably damaging	0.98
R8453:Mcf2l	UTSW	8	12984956	splice site	probably null
R8520:Mcf2l	UTSW	8	12880089	missense	probably benign
R8865:Mcf2l	UTSW	8	12880003	missense	probably benign	0.00
R8895:Mcf2l	UTSW	8	12984330	intron	probably benign
R9081:Mcf2l	UTSW	8	13018697	missense	probably damaging	0.96
R9143:Mcf2l	UTSW	8	13012883	splice site	probably benign
R9219:Mcf2l	UTSW	8	13011383	missense	probably damaging	0.98
R9229:Mcf2l	UTSW	8	13013584	missense	probably benign	0.01
R9335:Mcf2l	UTSW	8	13000812	missense	possibly damaging	0.92
R9351:Mcf2l	UTSW	8	13000757	missense	possibly damaging	0.82
R9406:Mcf2l	UTSW	8	13009676	missense	probably damaging	1.00
R9442:Mcf2l	UTSW	8	12973048	missense	possibly damaging	0.91
R9618:Mcf2l	UTSW	8	12984320	intron	probably benign
X0052:Mcf2l	UTSW	8	13018713	missense	possibly damaging	0.89
Z1177:Mcf2l	UTSW	8	13009654	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCATGTGGAACATTACAGCC -3'
(R):5'- CTTAGAGATTTGCATGCTGGTC -3'

Sequencing Primer
(F):5'- GTGGAACATTACAGCCAGTGACTTC -3'
(R):5'- TGGTCTACTGCACGGTGAC -3'

Posted On

2018-11-06