Incidental Mutation 'R6908:Dlc1'
ID 538866
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Name deleted in liver cancer 1
Synonyms p122-RhoGAP, Arhgap7, A730069N07Rik, STARD12
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 37034905-37420297 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37404841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 316 (F316S)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163663] [ENSMUST00000179501]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000163663
AA Change: F316S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: F316S

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179501
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 37,037,436 (GRCm39) utr 3 prime probably benign
IGL00807:Dlc1 APN 8 37,040,002 (GRCm39) missense probably benign 0.01
IGL00924:Dlc1 APN 8 37,405,368 (GRCm39) missense probably benign
IGL01349:Dlc1 APN 8 37,050,978 (GRCm39) missense probably damaging 0.96
IGL01419:Dlc1 APN 8 37,317,371 (GRCm39) missense probably benign 0.02
IGL01871:Dlc1 APN 8 37,317,334 (GRCm39) missense probably damaging 0.99
IGL01937:Dlc1 APN 8 37,317,345 (GRCm39) missense probably benign 0.25
IGL02525:Dlc1 APN 8 37,046,800 (GRCm39) missense probably damaging 1.00
IGL02696:Dlc1 APN 8 37,041,326 (GRCm39) missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 37,037,429 (GRCm39) utr 3 prime probably benign
IGL03029:Dlc1 APN 8 37,038,416 (GRCm39) splice site probably null
BB001:Dlc1 UTSW 8 37,038,570 (GRCm39) missense probably benign 0.03
BB011:Dlc1 UTSW 8 37,038,570 (GRCm39) missense probably benign 0.03
IGL02835:Dlc1 UTSW 8 37,051,055 (GRCm39) missense probably damaging 1.00
R0068:Dlc1 UTSW 8 37,404,875 (GRCm39) missense probably benign
R0068:Dlc1 UTSW 8 37,404,875 (GRCm39) missense probably benign
R0164:Dlc1 UTSW 8 37,066,594 (GRCm39) missense probably damaging 0.96
R0164:Dlc1 UTSW 8 37,066,594 (GRCm39) missense probably damaging 0.96
R0218:Dlc1 UTSW 8 37,317,383 (GRCm39) missense probably benign
R0419:Dlc1 UTSW 8 37,050,740 (GRCm39) missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 37,051,164 (GRCm39) missense probably damaging 1.00
R0645:Dlc1 UTSW 8 37,041,203 (GRCm39) missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 37,325,205 (GRCm39) missense probably benign
R0727:Dlc1 UTSW 8 37,039,828 (GRCm39) missense probably damaging 0.99
R0792:Dlc1 UTSW 8 37,405,702 (GRCm39) missense probably benign 0.00
R1061:Dlc1 UTSW 8 37,325,205 (GRCm39) missense probably benign
R1221:Dlc1 UTSW 8 37,051,985 (GRCm39) missense probably benign
R1440:Dlc1 UTSW 8 37,060,617 (GRCm39) splice site probably benign
R1501:Dlc1 UTSW 8 37,405,302 (GRCm39) missense probably benign 0.06
R1606:Dlc1 UTSW 8 37,317,406 (GRCm39) missense probably benign
R1707:Dlc1 UTSW 8 37,404,763 (GRCm39) missense probably benign 0.03
R1750:Dlc1 UTSW 8 37,325,244 (GRCm39) splice site probably null
R1762:Dlc1 UTSW 8 37,404,739 (GRCm39) missense probably benign 0.25
R2041:Dlc1 UTSW 8 37,049,922 (GRCm39) missense probably damaging 1.00
R2055:Dlc1 UTSW 8 37,060,535 (GRCm39) missense probably damaging 0.98
R2091:Dlc1 UTSW 8 37,404,763 (GRCm39) missense probably benign 0.00
R2987:Dlc1 UTSW 8 37,041,306 (GRCm39) missense probably damaging 0.97
R4285:Dlc1 UTSW 8 37,041,282 (GRCm39) missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 37,051,907 (GRCm39) missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 37,404,712 (GRCm39) critical splice donor site probably null
R4828:Dlc1 UTSW 8 37,317,400 (GRCm39) missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 37,051,799 (GRCm39) missense probably benign 0.01
R4902:Dlc1 UTSW 8 37,044,285 (GRCm39) missense probably damaging 1.00
R5067:Dlc1 UTSW 8 37,051,647 (GRCm39) missense probably benign 0.04
R5068:Dlc1 UTSW 8 37,405,184 (GRCm39) missense probably benign
R5198:Dlc1 UTSW 8 37,405,552 (GRCm39) missense probably damaging 1.00
R5471:Dlc1 UTSW 8 37,051,879 (GRCm39) missense probably benign 0.26
R5668:Dlc1 UTSW 8 37,404,655 (GRCm39) unclassified probably benign
R5915:Dlc1 UTSW 8 37,405,829 (GRCm39) utr 5 prime probably benign
R6323:Dlc1 UTSW 8 37,405,537 (GRCm39) missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 37,039,870 (GRCm39) missense probably damaging 1.00
R6914:Dlc1 UTSW 8 37,405,364 (GRCm39) missense probably benign
R6942:Dlc1 UTSW 8 37,405,364 (GRCm39) missense probably benign
R7269:Dlc1 UTSW 8 37,046,407 (GRCm39) missense probably damaging 1.00
R7271:Dlc1 UTSW 8 37,049,954 (GRCm39) missense probably damaging 0.99
R7462:Dlc1 UTSW 8 37,405,118 (GRCm39) missense unknown
R7548:Dlc1 UTSW 8 37,051,809 (GRCm39) missense probably benign 0.00
R7649:Dlc1 UTSW 8 37,049,894 (GRCm39) missense probably damaging 1.00
R7924:Dlc1 UTSW 8 37,038,570 (GRCm39) missense probably benign 0.03
R7960:Dlc1 UTSW 8 37,404,989 (GRCm39) missense probably benign
R7984:Dlc1 UTSW 8 37,405,472 (GRCm39) missense possibly damaging 0.85
R8227:Dlc1 UTSW 8 37,039,825 (GRCm39) missense probably damaging 1.00
R8491:Dlc1 UTSW 8 37,052,000 (GRCm39) missense probably benign
R8526:Dlc1 UTSW 8 37,404,968 (GRCm39) missense probably benign 0.00
R8715:Dlc1 UTSW 8 37,405,795 (GRCm39) start gained probably benign
R8887:Dlc1 UTSW 8 37,051,481 (GRCm39) missense probably benign 0.34
R8972:Dlc1 UTSW 8 37,405,394 (GRCm39) nonsense probably null
R8988:Dlc1 UTSW 8 37,039,997 (GRCm39) missense probably damaging 0.96
R9031:Dlc1 UTSW 8 37,405,055 (GRCm39) missense possibly damaging 0.95
R9080:Dlc1 UTSW 8 37,052,006 (GRCm39) missense probably benign
R9092:Dlc1 UTSW 8 37,199,860 (GRCm39) missense probably benign 0.03
R9096:Dlc1 UTSW 8 37,080,721 (GRCm39) missense probably benign 0.00
R9097:Dlc1 UTSW 8 37,080,721 (GRCm39) missense probably benign 0.00
R9166:Dlc1 UTSW 8 37,066,589 (GRCm39) missense probably damaging 1.00
R9187:Dlc1 UTSW 8 37,405,786 (GRCm39) start codon destroyed probably null 1.00
R9240:Dlc1 UTSW 8 37,052,005 (GRCm39) missense probably benign
R9276:Dlc1 UTSW 8 37,046,558 (GRCm39) missense possibly damaging 0.83
R9325:Dlc1 UTSW 8 37,038,518 (GRCm39) missense possibly damaging 0.83
Z1176:Dlc1 UTSW 8 37,051,365 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGCCCAAGCACATCC -3'
(R):5'- ATCTGACTTCCCTAAAGATGACCAG -3'

Sequencing Primer
(F):5'- GCCCAAGCACATCCATGAGTTATG -3'
(R):5'- GGAAAATAATCGGCACCATGTCTTAG -3'
Posted On 2018-11-06