Incidental Mutation 'R6908:Chd9'
ID 538868
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Name chromodomain helicase DNA binding protein 9
Synonyms AD013, 1810014J18Rik, 9030205D12Rik, A330063D19Rik
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 91554980-91781144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91683044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 495 (T495A)
Ref Sequence ENSEMBL: ENSMUSP00000147839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000209746] [ENSMUST00000210947] [ENSMUST00000211403]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: T495A
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: T495A

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: T495A
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: T495A

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209203
AA Change: T495A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: T495A
Predicted Effect silent
Transcript: ENSMUST00000209746
Predicted Effect probably benign
Transcript: ENSMUST00000210947
AA Change: T22A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211403
AA Change: T495A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91,752,020 (GRCm39) missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91,732,426 (GRCm39) missense probably damaging 1.00
IGL00589:Chd9 APN 8 91,742,474 (GRCm39) missense probably damaging 1.00
IGL00640:Chd9 APN 8 91,712,760 (GRCm39) missense probably damaging 0.99
IGL00663:Chd9 APN 8 91,710,118 (GRCm39) missense probably damaging 1.00
IGL00852:Chd9 APN 8 91,699,835 (GRCm39) missense probably benign 0.29
IGL00908:Chd9 APN 8 91,723,508 (GRCm39) missense probably damaging 1.00
IGL00911:Chd9 APN 8 91,778,320 (GRCm39) missense probably damaging 1.00
IGL01068:Chd9 APN 8 91,768,744 (GRCm39) missense probably benign 0.13
IGL01668:Chd9 APN 8 91,753,404 (GRCm39) missense possibly damaging 0.53
IGL01873:Chd9 APN 8 91,660,395 (GRCm39) missense probably benign 0.00
IGL01969:Chd9 APN 8 91,760,138 (GRCm39) missense possibly damaging 0.72
IGL02105:Chd9 APN 8 91,659,116 (GRCm39) missense probably damaging 1.00
IGL02153:Chd9 APN 8 91,683,122 (GRCm39) nonsense probably null
IGL02164:Chd9 APN 8 91,659,849 (GRCm39) missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91,778,312 (GRCm39) missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91,760,210 (GRCm39) missense probably benign 0.33
IGL02892:Chd9 APN 8 91,703,543 (GRCm39) splice site probably benign
IGL02897:Chd9 APN 8 91,660,496 (GRCm39) splice site probably benign
IGL03005:Chd9 APN 8 91,738,075 (GRCm39) missense probably damaging 0.98
IGL03062:Chd9 APN 8 91,741,895 (GRCm39) splice site probably benign
IGL03140:Chd9 APN 8 91,768,856 (GRCm39) missense possibly damaging 0.91
hovel UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
shack UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R0056:Chd9 UTSW 8 91,660,165 (GRCm39) missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91,735,464 (GRCm39) splice site probably null
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0238:Chd9 UTSW 8 91,659,456 (GRCm39) missense probably damaging 1.00
R0432:Chd9 UTSW 8 91,721,078 (GRCm39) splice site probably benign
R0454:Chd9 UTSW 8 91,699,859 (GRCm39) missense possibly damaging 0.83
R0573:Chd9 UTSW 8 91,725,223 (GRCm39) missense probably damaging 1.00
R0580:Chd9 UTSW 8 91,721,191 (GRCm39) missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91,763,170 (GRCm39) missense possibly damaging 0.82
R0662:Chd9 UTSW 8 91,704,304 (GRCm39) missense probably damaging 0.99
R0825:Chd9 UTSW 8 91,777,825 (GRCm39) missense probably benign 0.06
R0945:Chd9 UTSW 8 91,659,630 (GRCm39) missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91,741,832 (GRCm39) missense probably benign 0.19
R0967:Chd9 UTSW 8 91,716,107 (GRCm39) missense probably damaging 1.00
R1015:Chd9 UTSW 8 91,659,206 (GRCm39) missense probably damaging 0.99
R1066:Chd9 UTSW 8 91,712,764 (GRCm39) nonsense probably null
R1244:Chd9 UTSW 8 91,749,557 (GRCm39) missense probably damaging 0.99
R1505:Chd9 UTSW 8 91,733,123 (GRCm39) splice site probably null
R1570:Chd9 UTSW 8 91,763,170 (GRCm39) missense probably benign 0.03
R1591:Chd9 UTSW 8 91,710,166 (GRCm39) missense probably damaging 0.97
R1624:Chd9 UTSW 8 91,725,163 (GRCm39) missense probably benign 0.17
R1626:Chd9 UTSW 8 91,721,224 (GRCm39) missense probably benign 0.00
R1632:Chd9 UTSW 8 91,683,335 (GRCm39) nonsense probably null
R1649:Chd9 UTSW 8 91,659,229 (GRCm39) missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91,749,418 (GRCm39) splice site probably null
R1668:Chd9 UTSW 8 91,767,814 (GRCm39) missense probably damaging 0.99
R1681:Chd9 UTSW 8 91,699,763 (GRCm39) missense probably damaging 0.98
R1695:Chd9 UTSW 8 91,728,410 (GRCm39) missense probably damaging 1.00
R1714:Chd9 UTSW 8 91,760,853 (GRCm39) utr 3 prime probably benign
R1746:Chd9 UTSW 8 91,737,326 (GRCm39) missense probably benign 0.01
R1843:Chd9 UTSW 8 91,737,422 (GRCm39) missense probably benign 0.19
R1844:Chd9 UTSW 8 91,683,323 (GRCm39) nonsense probably null
R1941:Chd9 UTSW 8 91,703,697 (GRCm39) critical splice donor site probably null
R2022:Chd9 UTSW 8 91,761,682 (GRCm39) missense probably benign 0.17
R2027:Chd9 UTSW 8 91,634,619 (GRCm39) unclassified probably benign
R2098:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2099:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2100:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2101:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2224:Chd9 UTSW 8 91,737,913 (GRCm39) missense probably benign 0.04
R2276:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2278:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2316:Chd9 UTSW 8 91,777,756 (GRCm39) missense probably damaging 0.99
R2507:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2508:Chd9 UTSW 8 91,760,615 (GRCm39) missense probably benign 0.01
R2988:Chd9 UTSW 8 91,757,088 (GRCm39) splice site probably null
R3418:Chd9 UTSW 8 91,763,219 (GRCm39) missense probably damaging 1.00
R3817:Chd9 UTSW 8 91,710,893 (GRCm39) splice site probably benign
R3923:Chd9 UTSW 8 91,660,147 (GRCm39) missense probably benign 0.16
R4001:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4003:Chd9 UTSW 8 91,683,185 (GRCm39) missense probably damaging 1.00
R4006:Chd9 UTSW 8 91,660,188 (GRCm39) missense probably benign 0.12
R4013:Chd9 UTSW 8 91,699,797 (GRCm39) missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91,750,202 (GRCm39) missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91,737,304 (GRCm39) missense probably benign 0.04
R4125:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4126:Chd9 UTSW 8 91,777,912 (GRCm39) missense probably damaging 0.99
R4452:Chd9 UTSW 8 91,704,308 (GRCm39) missense probably damaging 0.99
R4463:Chd9 UTSW 8 91,705,627 (GRCm39) missense probably benign 0.01
R4478:Chd9 UTSW 8 91,760,659 (GRCm39) utr 3 prime probably benign
R4587:Chd9 UTSW 8 91,763,134 (GRCm39) missense possibly damaging 0.95
R4628:Chd9 UTSW 8 91,710,091 (GRCm39) missense probably benign 0.05
R4667:Chd9 UTSW 8 91,760,428 (GRCm39) missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91,741,877 (GRCm39) missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91,760,858 (GRCm39) missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91,760,336 (GRCm39) missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91,733,254 (GRCm39) nonsense probably null
R5083:Chd9 UTSW 8 91,711,002 (GRCm39) missense probably damaging 1.00
R5088:Chd9 UTSW 8 91,704,147 (GRCm39) missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91,753,462 (GRCm39) nonsense probably null
R5307:Chd9 UTSW 8 91,723,777 (GRCm39) missense probably damaging 1.00
R5541:Chd9 UTSW 8 91,778,132 (GRCm39) missense probably benign 0.09
R5559:Chd9 UTSW 8 91,742,553 (GRCm39) critical splice donor site probably null
R5638:Chd9 UTSW 8 91,738,078 (GRCm39) missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91,763,190 (GRCm39) missense probably damaging 1.00
R5793:Chd9 UTSW 8 91,728,384 (GRCm39) missense probably damaging 1.00
R5827:Chd9 UTSW 8 91,716,078 (GRCm39) missense probably damaging 1.00
R5834:Chd9 UTSW 8 91,723,792 (GRCm39) missense probably damaging 1.00
R5875:Chd9 UTSW 8 91,778,464 (GRCm39) missense probably damaging 0.99
R6002:Chd9 UTSW 8 91,705,515 (GRCm39) missense probably damaging 1.00
R6091:Chd9 UTSW 8 91,761,691 (GRCm39) missense probably damaging 1.00
R6185:Chd9 UTSW 8 91,775,765 (GRCm39) missense probably damaging 1.00
R6246:Chd9 UTSW 8 91,659,045 (GRCm39) missense probably damaging 1.00
R6292:Chd9 UTSW 8 91,659,550 (GRCm39) missense probably benign 0.05
R6305:Chd9 UTSW 8 91,757,174 (GRCm39) missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91,737,903 (GRCm39) missense possibly damaging 0.95
R6438:Chd9 UTSW 8 91,725,149 (GRCm39) missense probably benign 0.02
R6470:Chd9 UTSW 8 91,659,426 (GRCm39) missense probably damaging 1.00
R6798:Chd9 UTSW 8 91,778,182 (GRCm39) missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91,769,579 (GRCm39) missense probably damaging 1.00
R6929:Chd9 UTSW 8 91,769,573 (GRCm39) missense probably damaging 1.00
R6969:Chd9 UTSW 8 91,705,542 (GRCm39) missense probably benign 0.34
R7043:Chd9 UTSW 8 91,760,843 (GRCm39) utr 3 prime probably benign
R7094:Chd9 UTSW 8 91,716,189 (GRCm39) missense unknown
R7126:Chd9 UTSW 8 91,741,853 (GRCm39) missense unknown
R7182:Chd9 UTSW 8 91,733,250 (GRCm39) missense unknown
R7219:Chd9 UTSW 8 91,728,394 (GRCm39) missense unknown
R7260:Chd9 UTSW 8 91,721,171 (GRCm39) missense unknown
R7293:Chd9 UTSW 8 91,760,707 (GRCm39) missense unknown
R7303:Chd9 UTSW 8 91,778,532 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,760,846 (GRCm39) missense unknown
R7358:Chd9 UTSW 8 91,710,115 (GRCm39) missense unknown
R7451:Chd9 UTSW 8 91,760,446 (GRCm39) missense probably benign 0.27
R7451:Chd9 UTSW 8 91,760,418 (GRCm39) frame shift probably null
R7456:Chd9 UTSW 8 91,659,153 (GRCm39) nonsense probably null
R7481:Chd9 UTSW 8 91,683,066 (GRCm39) missense unknown
R7532:Chd9 UTSW 8 91,721,193 (GRCm39) missense unknown
R7570:Chd9 UTSW 8 91,721,208 (GRCm39) missense unknown
R7611:Chd9 UTSW 8 91,763,017 (GRCm39) missense probably damaging 1.00
R7673:Chd9 UTSW 8 91,778,325 (GRCm39) missense probably damaging 0.96
R7723:Chd9 UTSW 8 91,741,837 (GRCm39) missense unknown
R7739:Chd9 UTSW 8 91,761,653 (GRCm39) missense probably damaging 1.00
R7759:Chd9 UTSW 8 91,704,178 (GRCm39) critical splice donor site probably null
R7916:Chd9 UTSW 8 91,761,684 (GRCm39) nonsense probably null
R7921:Chd9 UTSW 8 91,768,909 (GRCm39) critical splice donor site probably null
R7957:Chd9 UTSW 8 91,778,326 (GRCm39) missense probably damaging 0.99
R7972:Chd9 UTSW 8 91,732,395 (GRCm39) missense unknown
R8108:Chd9 UTSW 8 91,659,852 (GRCm39) missense unknown
R8115:Chd9 UTSW 8 91,762,960 (GRCm39) missense probably damaging 0.99
R8165:Chd9 UTSW 8 91,767,769 (GRCm39) missense probably damaging 1.00
R8171:Chd9 UTSW 8 91,752,015 (GRCm39) missense possibly damaging 0.92
R8186:Chd9 UTSW 8 91,725,233 (GRCm39) missense unknown
R8208:Chd9 UTSW 8 91,763,891 (GRCm39) splice site probably null
R8256:Chd9 UTSW 8 91,660,129 (GRCm39) missense unknown
R8281:Chd9 UTSW 8 91,763,225 (GRCm39) missense probably damaging 1.00
R8504:Chd9 UTSW 8 91,723,472 (GRCm39) missense unknown
R8836:Chd9 UTSW 8 91,767,812 (GRCm39) missense probably damaging 0.99
R8892:Chd9 UTSW 8 91,660,468 (GRCm39) missense unknown
R8985:Chd9 UTSW 8 91,721,101 (GRCm39) missense unknown
R9029:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9030:Chd9 UTSW 8 91,683,198 (GRCm39) missense unknown
R9038:Chd9 UTSW 8 91,716,233 (GRCm39) missense unknown
R9081:Chd9 UTSW 8 91,704,144 (GRCm39) nonsense probably null
R9134:Chd9 UTSW 8 91,659,754 (GRCm39) missense unknown
R9205:Chd9 UTSW 8 91,757,270 (GRCm39) missense probably benign 0.01
R9309:Chd9 UTSW 8 91,733,319 (GRCm39) missense unknown
R9375:Chd9 UTSW 8 91,725,335 (GRCm39) critical splice donor site probably null
R9449:Chd9 UTSW 8 91,659,174 (GRCm39) missense unknown
R9547:Chd9 UTSW 8 91,683,186 (GRCm39) missense unknown
R9573:Chd9 UTSW 8 91,704,302 (GRCm39) missense unknown
R9576:Chd9 UTSW 8 91,659,294 (GRCm39) missense unknown
R9601:Chd9 UTSW 8 91,732,360 (GRCm39) nonsense probably null
R9613:Chd9 UTSW 8 91,683,150 (GRCm39) nonsense probably null
R9639:Chd9 UTSW 8 91,760,840 (GRCm39) missense probably null
R9718:Chd9 UTSW 8 91,712,801 (GRCm39) missense unknown
R9746:Chd9 UTSW 8 91,738,063 (GRCm39) missense unknown
R9762:Chd9 UTSW 8 91,712,741 (GRCm39) missense unknown
R9764:Chd9 UTSW 8 91,721,220 (GRCm39) missense unknown
R9790:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
R9791:Chd9 UTSW 8 91,760,417 (GRCm39) missense possibly damaging 0.82
RF007:Chd9 UTSW 8 91,760,578 (GRCm39) missense possibly damaging 0.66
X0065:Chd9 UTSW 8 91,763,200 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTAGCTGAGCTGTGC -3'
(R):5'- CTAGGAAAGTTCTCAGGGCTC -3'

Sequencing Primer
(F):5'- TCCTAACTTCCAGGTGAGCAGAG -3'
(R):5'- GGAAAGTTCTCAGGGCTCATTACTC -3'
Posted On 2018-11-06