Incidental Mutation 'R6908:Bbs9'
ID 538869
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene Name Bardet-Biedl syndrome 9
Synonyms E130103I17Rik, EST 3159894
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.827) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22387011-22799576 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 22479019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 154 (I154S)
Ref Sequence ENSEMBL: ENSMUSP00000116629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
AlphaFold Q811G0
Predicted Effect probably damaging
Transcript: ENSMUST00000039798
AA Change: I154S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147405
AA Change: I154S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147712
AA Change: I154S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150395
AA Change: I154S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22,798,979 (GRCm39) missense probably benign 0.00
IGL01586:Bbs9 APN 9 22,557,293 (GRCm39) missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22,582,221 (GRCm39) nonsense probably null
IGL01654:Bbs9 APN 9 22,402,238 (GRCm39) critical splice donor site probably null
IGL02172:Bbs9 APN 9 22,490,772 (GRCm39) missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22,723,808 (GRCm39) missense probably benign 0.02
IGL02444:Bbs9 APN 9 22,555,083 (GRCm39) missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22,490,780 (GRCm39) missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22,555,044 (GRCm39) missense probably benign 0.19
corpulent UTSW 9 22,486,492 (GRCm39) critical splice donor site probably null
Crapulence UTSW 9 22,479,060 (GRCm39) missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22,415,390 (GRCm39) missense probably benign 0.30
R0243:Bbs9 UTSW 9 22,425,297 (GRCm39) missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22,408,111 (GRCm39) missense probably benign
R0688:Bbs9 UTSW 9 22,479,015 (GRCm39) missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22,705,119 (GRCm39) missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22,486,497 (GRCm39) splice site probably null
R0783:Bbs9 UTSW 9 22,479,010 (GRCm39) missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22,486,396 (GRCm39) splice site probably benign
R1532:Bbs9 UTSW 9 22,798,945 (GRCm39) missense probably benign 0.00
R1783:Bbs9 UTSW 9 22,570,415 (GRCm39) missense possibly damaging 0.85
R2285:Bbs9 UTSW 9 22,590,230 (GRCm39) missense probably damaging 1.00
R2402:Bbs9 UTSW 9 22,557,359 (GRCm39) missense probably benign 0.23
R2655:Bbs9 UTSW 9 22,415,348 (GRCm39) missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22,479,183 (GRCm39) splice site probably benign
R3798:Bbs9 UTSW 9 22,550,065 (GRCm39) missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22,798,926 (GRCm39) missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22,490,063 (GRCm39) missense probably benign 0.16
R4873:Bbs9 UTSW 9 22,490,011 (GRCm39) missense probably benign 0.06
R4875:Bbs9 UTSW 9 22,490,011 (GRCm39) missense probably benign 0.06
R5291:Bbs9 UTSW 9 22,540,293 (GRCm39) missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22,486,492 (GRCm39) critical splice donor site probably null
R5502:Bbs9 UTSW 9 22,415,370 (GRCm39) missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22,490,011 (GRCm39) missense probably benign 0.06
R5932:Bbs9 UTSW 9 22,723,627 (GRCm39) missense probably damaging 1.00
R6222:Bbs9 UTSW 9 22,479,147 (GRCm39) missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22,479,060 (GRCm39) missense probably damaging 1.00
R6547:Bbs9 UTSW 9 22,425,365 (GRCm39) missense probably benign 0.01
R6726:Bbs9 UTSW 9 22,557,260 (GRCm39) missense probably benign 0.00
R6745:Bbs9 UTSW 9 22,582,132 (GRCm39) missense probably benign 0.00
R6919:Bbs9 UTSW 9 22,723,840 (GRCm39) critical splice donor site probably null
R7102:Bbs9 UTSW 9 22,490,849 (GRCm39) missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22,582,096 (GRCm39) missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22,582,109 (GRCm39) missense probably benign 0.34
R8177:Bbs9 UTSW 9 22,425,359 (GRCm39) missense probably benign 0.08
R8190:Bbs9 UTSW 9 22,590,284 (GRCm39) missense probably damaging 1.00
R8241:Bbs9 UTSW 9 22,590,214 (GRCm39) missense probably benign 0.00
R8440:Bbs9 UTSW 9 22,479,046 (GRCm39) missense probably damaging 0.99
R8733:Bbs9 UTSW 9 22,582,128 (GRCm39) missense probably benign 0.03
R8737:Bbs9 UTSW 9 22,590,244 (GRCm39) missense probably benign 0.17
R8854:Bbs9 UTSW 9 22,490,060 (GRCm39) missense probably damaging 1.00
R8885:Bbs9 UTSW 9 22,590,234 (GRCm39) missense possibly damaging 0.67
R9135:Bbs9 UTSW 9 22,490,005 (GRCm39) missense probably damaging 1.00
X0027:Bbs9 UTSW 9 22,566,626 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGATATTTCCACTGGCTTG -3'
(R):5'- GTGATGATCTAAGCCAACCCAG -3'

Sequencing Primer
(F):5'- CCTGATATTTCCACTGGCTTGTAAAG -3'
(R):5'- ACCAAAGAAGCCAGTAATTTCTTC -3'
Posted On 2018-11-06