Incidental Mutation 'R6908:Bbs9'
ID 538869
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene Name Bardet-Biedl syndrome 9 (human)
Synonyms E130103I17Rik, EST 3159894
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22475715-22888280 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 22567723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 154 (I154S)
Ref Sequence ENSEMBL: ENSMUSP00000116629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
AlphaFold Q811G0
Predicted Effect probably damaging
Transcript: ENSMUST00000039798
AA Change: I154S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147405
AA Change: I154S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147712
AA Change: I154S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150395
AA Change: I154S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: I154S

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22887683 missense probably benign 0.00
IGL01586:Bbs9 APN 9 22645997 missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22670925 nonsense probably null
IGL01654:Bbs9 APN 9 22490942 critical splice donor site probably null
IGL02172:Bbs9 APN 9 22579476 missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22812512 missense probably benign 0.02
IGL02444:Bbs9 APN 9 22643787 missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22579484 missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22643748 missense probably benign 0.19
corpulent UTSW 9 22575196 critical splice donor site probably null
Crapulence UTSW 9 22567764 missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22504094 missense probably benign 0.30
R0243:Bbs9 UTSW 9 22514001 missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22496815 missense probably benign
R0688:Bbs9 UTSW 9 22567719 missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22793823 missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22575201 splice site probably null
R0783:Bbs9 UTSW 9 22567714 missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22575100 splice site probably benign
R1532:Bbs9 UTSW 9 22887649 missense probably benign 0.00
R1783:Bbs9 UTSW 9 22659119 missense possibly damaging 0.85
R2285:Bbs9 UTSW 9 22678934 missense probably damaging 1.00
R2402:Bbs9 UTSW 9 22646063 missense probably benign 0.23
R2655:Bbs9 UTSW 9 22504052 missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22567887 splice site probably benign
R3798:Bbs9 UTSW 9 22638769 missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22887630 missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22578767 missense probably benign 0.16
R4873:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R4875:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5291:Bbs9 UTSW 9 22628997 missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22575196 critical splice donor site probably null
R5502:Bbs9 UTSW 9 22504074 missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5932:Bbs9 UTSW 9 22812331 missense probably damaging 1.00
R6222:Bbs9 UTSW 9 22567851 missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22567764 missense probably damaging 1.00
R6547:Bbs9 UTSW 9 22514069 missense probably benign 0.01
R6726:Bbs9 UTSW 9 22645964 missense probably benign 0.00
R6745:Bbs9 UTSW 9 22670836 missense probably benign 0.00
R6919:Bbs9 UTSW 9 22812544 critical splice donor site probably null
R7102:Bbs9 UTSW 9 22579553 missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22670800 missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22670813 missense probably benign 0.34
R8177:Bbs9 UTSW 9 22514063 missense probably benign 0.08
R8190:Bbs9 UTSW 9 22678988 missense probably damaging 1.00
R8241:Bbs9 UTSW 9 22678918 missense probably benign 0.00
R8440:Bbs9 UTSW 9 22567750 missense probably damaging 0.99
R8733:Bbs9 UTSW 9 22670832 missense probably benign 0.03
R8737:Bbs9 UTSW 9 22678948 missense probably benign 0.17
R8854:Bbs9 UTSW 9 22578764 missense probably damaging 1.00
R8885:Bbs9 UTSW 9 22678938 missense possibly damaging 0.67
R9135:Bbs9 UTSW 9 22578709 missense probably damaging 1.00
X0027:Bbs9 UTSW 9 22655330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGATATTTCCACTGGCTTG -3'
(R):5'- GTGATGATCTAAGCCAACCCAG -3'

Sequencing Primer
(F):5'- CCTGATATTTCCACTGGCTTGTAAAG -3'
(R):5'- ACCAAAGAAGCCAGTAATTTCTTC -3'
Posted On 2018-11-06