Incidental Mutation 'R6908:Dnajc12'
ID 538875
Institutional Source Beutler Lab
Gene Symbol Dnajc12
Ensembl Gene ENSMUSG00000036764
Gene Name DnaJ heat shock protein family (Hsp40) member C12
Synonyms Jdp1, J domain protein 1, mJDP1
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 63218222-63244619 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 63233104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 82 (Q82K)
Ref Sequence ENSEMBL: ENSMUSP00000041298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043317] [ENSMUST00000129625]
AlphaFold Q9R022
Predicted Effect probably benign
Transcript: ENSMUST00000043317
AA Change: Q82K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000041298
Gene: ENSMUSG00000036764
AA Change: Q82K

DomainStartEndE-ValueType
DnaJ 13 71 1.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129625
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subclass of the HSP40/DnaJ protein family. Members of this family of proteins are associated with complex assembly, protein folding, and export. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Dnajc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Dnajc12 APN 10 63,231,609 (GRCm39) missense probably damaging 1.00
IGL02276:Dnajc12 APN 10 63,244,037 (GRCm39) missense probably damaging 1.00
IGL02669:Dnajc12 APN 10 63,233,071 (GRCm39) missense probably damaging 0.99
R1473:Dnajc12 UTSW 10 63,233,023 (GRCm39) missense probably benign 0.01
R2321:Dnajc12 UTSW 10 63,242,990 (GRCm39) splice site probably benign
R4391:Dnajc12 UTSW 10 63,242,838 (GRCm39) missense probably benign 0.02
R4703:Dnajc12 UTSW 10 63,222,429 (GRCm39) splice site probably null
R4726:Dnajc12 UTSW 10 63,233,087 (GRCm39) missense probably damaging 1.00
R5004:Dnajc12 UTSW 10 63,222,486 (GRCm39) missense probably benign 0.00
R6291:Dnajc12 UTSW 10 63,233,053 (GRCm39) missense probably benign 0.00
R7010:Dnajc12 UTSW 10 63,233,059 (GRCm39) missense probably benign
R7696:Dnajc12 UTSW 10 63,242,911 (GRCm39) missense probably benign
R7812:Dnajc12 UTSW 10 63,242,905 (GRCm39) missense probably benign 0.00
R9619:Dnajc12 UTSW 10 63,233,075 (GRCm39) missense probably damaging 1.00
Z1177:Dnajc12 UTSW 10 63,233,039 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGACACTAAAGCCTGACTAG -3'
(R):5'- ATGACTTACCACTAATTTCTCAGCC -3'

Sequencing Primer
(F):5'- GTCTCAAAGTCAAAATTCTGGCGAG -3'
(R):5'- ACCACTAATTTCTCAGCCCCTTTC -3'
Posted On 2018-11-06