Incidental Mutation 'R6908:Nlrp1b'
ID 538878
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene Name NLR family, pyrin domain containing 1B
Synonyms Nalp1b
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 71043928-71121559 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71108122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 460 (I460V)
Ref Sequence ENSEMBL: ENSMUSP00000121155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108516] [ENSMUST00000136493]
AlphaFold A1Z198
Predicted Effect probably benign
Transcript: ENSMUST00000094046
AA Change: I460V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: I460V

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
AA Change: I460V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: I460V

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
AA Change: I460V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390
AA Change: I460V

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71,072,007 (GRCm39) intron probably benign
IGL00571:Nlrp1b APN 11 71,054,799 (GRCm39) missense probably null 0.48
IGL01358:Nlrp1b APN 11 71,072,682 (GRCm39) missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71,072,233 (GRCm39) missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71,072,233 (GRCm39) missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71,052,506 (GRCm39) missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71,063,057 (GRCm39) missense possibly damaging 0.96
IGL02552:Nlrp1b APN 11 71,072,878 (GRCm39) missense possibly damaging 0.57
IGL02588:Nlrp1b APN 11 71,073,105 (GRCm39) nonsense probably null
IGL02833:Nlrp1b APN 11 71,051,998 (GRCm39) missense probably benign
IGL02955:Nlrp1b APN 11 71,060,637 (GRCm39) missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71,059,685 (GRCm39) missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71,052,665 (GRCm39) missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71,072,659 (GRCm39) missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71,052,741 (GRCm39) missense possibly damaging 0.82
androcles UTSW 11 71,062,901 (GRCm39) nonsense probably null
Fangled UTSW 11 71,062,997 (GRCm39) missense possibly damaging 0.94
glitz UTSW 11 71,072,376 (GRCm39) missense possibly damaging 0.89
honeydew UTSW 11 71,108,710 (GRCm39) missense possibly damaging 0.93
Mush UTSW 11 71,046,905 (GRCm39) missense probably damaging 1.00
Thorn UTSW 11 71,047,126 (GRCm39) splice site probably benign
R0001:Nlrp1b UTSW 11 71,052,585 (GRCm39) missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71,052,755 (GRCm39) missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71,052,755 (GRCm39) missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71,062,997 (GRCm39) missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71,062,997 (GRCm39) missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71,054,925 (GRCm39) missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71,054,925 (GRCm39) missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71,052,591 (GRCm39) missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71,109,070 (GRCm39) missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71,073,241 (GRCm39) missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71,047,005 (GRCm39) missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71,072,173 (GRCm39) missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71,072,512 (GRCm39) missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71,072,290 (GRCm39) missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71,046,885 (GRCm39) missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71,072,124 (GRCm39) missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71,092,085 (GRCm39) missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71,073,637 (GRCm39) missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71,107,681 (GRCm39) critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71,092,099 (GRCm39) missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71,050,979 (GRCm39) missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71,052,647 (GRCm39) missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71,073,442 (GRCm39) missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71,072,964 (GRCm39) missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71,051,912 (GRCm39) missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71,060,621 (GRCm39) missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71,046,815 (GRCm39) splice site probably benign
R2284:Nlrp1b UTSW 11 71,047,110 (GRCm39) missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71,047,552 (GRCm39) splice site probably null
R3079:Nlrp1b UTSW 11 71,108,794 (GRCm39) missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71,047,126 (GRCm39) splice site probably benign
R3980:Nlrp1b UTSW 11 71,072,437 (GRCm39) missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71,063,911 (GRCm39) missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71,052,588 (GRCm39) missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71,119,151 (GRCm39) missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71,052,669 (GRCm39) missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71,072,232 (GRCm39) missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71,073,489 (GRCm39) missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71,108,710 (GRCm39) missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71,108,103 (GRCm39) missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71,109,160 (GRCm39) missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71,050,898 (GRCm39) missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71,072,359 (GRCm39) missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
R5388:Nlrp1b UTSW 11 71,062,967 (GRCm39) missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71,108,701 (GRCm39) missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71,108,102 (GRCm39) missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71,072,229 (GRCm39) missense probably benign
R5826:Nlrp1b UTSW 11 71,072,022 (GRCm39) missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71,108,691 (GRCm39) missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71,072,572 (GRCm39) missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71,107,836 (GRCm39) missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71,046,905 (GRCm39) missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71,109,283 (GRCm39) nonsense probably null
R6250:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71,119,223 (GRCm39) missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71,072,527 (GRCm39) missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71,108,530 (GRCm39) missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71,119,259 (GRCm39) missense possibly damaging 0.93
R6938:Nlrp1b UTSW 11 71,109,042 (GRCm39) missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71,109,100 (GRCm39) missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71,062,901 (GRCm39) nonsense probably null
R7149:Nlrp1b UTSW 11 71,072,482 (GRCm39) nonsense probably null
R7349:Nlrp1b UTSW 11 71,072,943 (GRCm39) missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71,072,376 (GRCm39) missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71,059,665 (GRCm39) missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71,108,537 (GRCm39) missense possibly damaging 0.93
R8031:Nlrp1b UTSW 11 71,107,747 (GRCm39) missense probably benign 0.15
R8087:Nlrp1b UTSW 11 71,062,897 (GRCm39) missense probably benign 0.04
R8164:Nlrp1b UTSW 11 71,119,243 (GRCm39) missense possibly damaging 0.78
R8378:Nlrp1b UTSW 11 71,052,545 (GRCm39) missense possibly damaging 0.95
R8405:Nlrp1b UTSW 11 71,073,356 (GRCm39) missense possibly damaging 0.66
R8441:Nlrp1b UTSW 11 71,073,204 (GRCm39) missense probably damaging 1.00
R8792:Nlrp1b UTSW 11 71,050,919 (GRCm39) missense probably benign 0.02
R8898:Nlrp1b UTSW 11 71,073,288 (GRCm39) missense probably damaging 1.00
R8953:Nlrp1b UTSW 11 71,052,632 (GRCm39) missense probably damaging 0.96
R8963:Nlrp1b UTSW 11 71,108,658 (GRCm39) missense probably damaging 1.00
R9145:Nlrp1b UTSW 11 71,109,193 (GRCm39) missense probably benign
R9184:Nlrp1b UTSW 11 71,072,067 (GRCm39) missense probably damaging 1.00
R9286:Nlrp1b UTSW 11 71,060,573 (GRCm39) missense probably benign
R9322:Nlrp1b UTSW 11 71,108,118 (GRCm39) missense probably benign 0.12
R9453:Nlrp1b UTSW 11 71,072,913 (GRCm39) missense probably damaging 0.98
R9533:Nlrp1b UTSW 11 71,109,095 (GRCm39) missense probably benign 0.12
R9659:Nlrp1b UTSW 11 71,073,132 (GRCm39) missense possibly damaging 0.77
Z1176:Nlrp1b UTSW 11 71,073,096 (GRCm39) missense probably damaging 1.00
Z1177:Nlrp1b UTSW 11 71,108,050 (GRCm39) missense probably benign 0.03
Z1177:Nlrp1b UTSW 11 71,072,125 (GRCm39) nonsense probably null
Z1186:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1186:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1186:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1186:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1187:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1187:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1187:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1188:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1188:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1188:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1189:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1189:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1189:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1190:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1190:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1190:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1191:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,135 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,072,539 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1191:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1191:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71,073,396 (GRCm39) missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71,073,378 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,073,370 (GRCm39) missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71,073,280 (GRCm39) missense probably benign 0.00
Z1192:Nlrp1b UTSW 11 71,073,266 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,073,148 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,072,625 (GRCm39) missense probably benign
Z1192:Nlrp1b UTSW 11 71,072,534 (GRCm39) missense probably benign 0.02
Z1192:Nlrp1b UTSW 11 71,073,503 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGCAAACCCAGATGATG -3'
(R):5'- AGTGAAAGCGACCTCTGTAAGC -3'

Sequencing Primer
(F):5'- CAAACCCAGATGATGTTGATAGGTTG -3'
(R):5'- CCTCTGTAAGCAAGGGTTAGC -3'
Posted On 2018-11-06