Incidental Mutation 'R6908:Nmt1'
ID 538880
Institutional Source Beutler Lab
Gene Symbol Nmt1
Ensembl Gene ENSMUSG00000020936
Gene Name N-myristoyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 103028190-103068912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103058254 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 312 (S312A)
Ref Sequence ENSEMBL: ENSMUSP00000021314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314]
AlphaFold O70310
Predicted Effect possibly damaging
Transcript: ENSMUST00000021314
AA Change: S312A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: S312A

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Nmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Nmt1 APN 11 103060076 critical splice acceptor site probably null
IGL02058:Nmt1 APN 11 103052290 missense probably benign 0.00
IGL02582:Nmt1 APN 11 103064799 missense possibly damaging 0.94
cropped UTSW 11 103056459 missense probably damaging 1.00
R0092:Nmt1 UTSW 11 103046493 missense probably damaging 1.00
R1401:Nmt1 UTSW 11 103057481 missense probably damaging 0.99
R1827:Nmt1 UTSW 11 103064838 missense probably damaging 1.00
R1878:Nmt1 UTSW 11 103052251 missense probably benign
R2199:Nmt1 UTSW 11 103063856 missense probably damaging 1.00
R3930:Nmt1 UTSW 11 103052233 missense probably benign 0.37
R4373:Nmt1 UTSW 11 103043200 missense probably damaging 0.99
R4648:Nmt1 UTSW 11 103063917 missense probably damaging 1.00
R5666:Nmt1 UTSW 11 103058215 nonsense probably null
R7315:Nmt1 UTSW 11 103060183 missense probably benign
R7473:Nmt1 UTSW 11 103046400 missense probably benign 0.05
R7504:Nmt1 UTSW 11 103056459 missense probably damaging 1.00
R8548:Nmt1 UTSW 11 103043226 missense possibly damaging 0.80
R8913:Nmt1 UTSW 11 103057445 missense probably damaging 1.00
X0018:Nmt1 UTSW 11 103028586 missense probably benign 0.01
Z1177:Nmt1 UTSW 11 103055213 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGGCTTCTGAAATGGAAGAGC -3'
(R):5'- CTACTAAGCCAGGCATAGACGAG -3'

Sequencing Primer
(F):5'- AAGATTCCCTGGCCCCCTG -3'
(R):5'- CCAGGCATAGACGAGGCAGG -3'
Posted On 2018-11-06