Mutagenetix > Incidental Mutations

Incidental Mutation 'R6908:Ripor2'

538883

Institutional Source

Beutler Lab

Gene Symbol

Ripor2

Ensembl Gene

ENSMUSG00000036006

Gene Name

RHO family interacting cell polarization regulator 2

Synonyms

6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24582189-24733816 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24706232 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 697 (G697S)

Ref Sequence

ENSEMBL: ENSMUSP00000106013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]

Predicted Effect

probably benign
Transcript: ENSMUST00000038477

SMART Domains

Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006

Domain	Start	End	E-Value	Type
coiled coil region	108	137	N/A	INTRINSIC
low complexity region	461	476	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091694

SMART Domains

Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
coiled coil region	111	140	N/A	INTRINSIC
low complexity region	422	437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110383
AA Change: G672S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: G672S

Domain	Start	End	E-Value	Type
coiled coil region	83	112	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	630	639	N/A	INTRINSIC
low complexity region	657	672	N/A	INTRINSIC
low complexity region	857	864	N/A	INTRINSIC
SCOP:d1gw5a_	901	1023	2e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110384
AA Change: G697S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: G697S

Domain	Start	End	E-Value	Type
Pfam:PL48	41	389	6e-174	PFAM
low complexity region	461	476	N/A	INTRINSIC
low complexity region	655	664	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	882	889	N/A	INTRINSIC
SCOP:d1gw5a_	926	1048	2e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132689

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Ripor2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Ripor2	APN	13	24701207	missense	probably benign	0.11
IGL02145:Ripor2	APN	13	24717571	missense	probably damaging	1.00
IGL02351:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02358:Ripor2	APN	13	24731589	missense	probably damaging	1.00
IGL02377:Ripor2	APN	13	24695566	splice site	probably benign
IGL02533:Ripor2	APN	13	24701395	nonsense	probably null
IGL02798:Ripor2	APN	13	24674666	missense	probably damaging	0.99
IGL02852:Ripor2	APN	13	24695698	missense	probably damaging	1.00
IGL02869:Ripor2	APN	13	24696529	missense	possibly damaging	0.46
IGL03219:Ripor2	APN	13	24723719	missense	probably damaging	1.00
gentleman	UTSW	13	24694145	missense	probably damaging	1.00
Jack	UTSW	13	24677841	nonsense	probably null
whitechapel	UTSW	13	24673112	critical splice donor site	probably null
R0045:Ripor2	UTSW	13	24694226	missense	probably damaging	1.00
R0101:Ripor2	UTSW	13	24680632	missense	probably damaging	1.00
R0731:Ripor2	UTSW	13	24680644	missense	probably damaging	1.00
R0827:Ripor2	UTSW	13	24694186	missense	probably damaging	1.00
R1331:Ripor2	UTSW	13	24677841	nonsense	probably null
R1374:Ripor2	UTSW	13	24673112	critical splice donor site	probably null
R1564:Ripor2	UTSW	13	24675785	missense	probably damaging	1.00
R1773:Ripor2	UTSW	13	24701254	missense	probably benign	0.10
R1889:Ripor2	UTSW	13	24693887	missense	probably damaging	1.00
R2122:Ripor2	UTSW	13	24713718	missense	probably damaging	0.98
R2137:Ripor2	UTSW	13	24721834	critical splice donor site	probably null
R2209:Ripor2	UTSW	13	24701612	missense	probably damaging	1.00
R2242:Ripor2	UTSW	13	24671772	missense	probably benign	0.08
R2392:Ripor2	UTSW	13	24706223	missense	probably benign	0.00
R2994:Ripor2	UTSW	13	24701627	missense	probably damaging	0.98
R4008:Ripor2	UTSW	13	24696538	missense	probably benign
R4287:Ripor2	UTSW	13	24725009	missense	probably damaging	1.00
R4364:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4365:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4366:Ripor2	UTSW	13	24721711	missense	probably benign	0.07
R4868:Ripor2	UTSW	13	24694141	missense	possibly damaging	0.88
R5304:Ripor2	UTSW	13	24674666	missense	probably damaging	0.99
R6119:Ripor2	UTSW	13	24614644	start gained	probably benign
R6157:Ripor2	UTSW	13	24701069	missense	probably damaging	1.00
R6178:Ripor2	UTSW	13	24710130	missense	possibly damaging	0.94
R6382:Ripor2	UTSW	13	24677845	missense	possibly damaging	0.89
R6664:Ripor2	UTSW	13	24675820	missense	probably damaging	0.98
R7023:Ripor2	UTSW	13	24671846	missense	probably benign	0.00
R7041:Ripor2	UTSW	13	24693766	missense	probably benign	0.18
R7196:Ripor2	UTSW	13	24704825	missense	possibly damaging	0.66
R7216:Ripor2	UTSW	13	24671903	missense	probably damaging	1.00
R7248:Ripor2	UTSW	13	24694145	missense	probably damaging	1.00
R7299:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7301:Ripor2	UTSW	13	24725001	missense	possibly damaging	0.54
R7343:Ripor2	UTSW	13	24701444	nonsense	probably null
R7417:Ripor2	UTSW	13	24696550	missense	probably damaging	1.00
R7426:Ripor2	UTSW	13	24694205	missense	probably benign	0.01
R7448:Ripor2	UTSW	13	24670071	missense	possibly damaging	0.71
R7462:Ripor2	UTSW	13	24696307	missense	unknown
R7499:Ripor2	UTSW	13	24693772	missense	probably damaging	0.99
R8081:Ripor2	UTSW	13	24713700	missense	probably benign	0.01
R8157:Ripor2	UTSW	13	24695617	missense	probably benign	0.05
R8364:Ripor2	UTSW	13	24710193	missense	possibly damaging	0.95
R8447:Ripor2	UTSW	13	24723788	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAAAGTGTCACGTTTCCCAC -3'
(R):5'- TGCATATCAAGTCATCCGCAG -3'

Sequencing Primer
(F):5'- TGCCATGAGTCCTGCCAGTG -3'
(R):5'- CCATATGCGGTTGGACATGAC -3'

Posted On

2018-11-06