Incidental Mutation 'R6908:Prss51'
ID 538885
Institutional Source Beutler Lab
Gene Symbol Prss51
Ensembl Gene ENSMUSG00000052099
Gene Name protease, serine 51
Synonyms 1700007N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 64086234-64097678 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64096152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 70 (A70V)
Ref Sequence ENSEMBL: ENSMUSP00000126778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063785] [ENSMUST00000165710] [ENSMUST00000170709] [ENSMUST00000224112]
AlphaFold A0A286YDY8
Predicted Effect probably benign
Transcript: ENSMUST00000063785
AA Change: A70V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000066111
Gene: ENSMUSG00000052099
AA Change: A70V

DomainStartEndE-ValueType
Tryp_SPc 5 171 3.93e-9 SMART
low complexity region 181 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165710
AA Change: A88V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132814
Gene: ENSMUSG00000052099
AA Change: A88V

DomainStartEndE-ValueType
Tryp_SPc 9 189 2.09e-13 SMART
low complexity region 199 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170709
AA Change: A70V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126778
Gene: ENSMUSG00000052099
AA Change: A70V

DomainStartEndE-ValueType
Pfam:Trypsin 2 94 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224112
AA Change: A167V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Prss51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Prss51 APN 14 64095984 missense probably damaging 1.00
PIT4354001:Prss51 UTSW 14 64097097 missense probably damaging 0.99
R0453:Prss51 UTSW 14 64097139 missense probably damaging 1.00
R1335:Prss51 UTSW 14 64096171 critical splice donor site probably null
R1479:Prss51 UTSW 14 64096170 critical splice donor site probably null
R3753:Prss51 UTSW 14 64096175 splice site probably benign
R5384:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5385:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5386:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R6522:Prss51 UTSW 14 64097406 missense possibly damaging 0.90
R6722:Prss51 UTSW 14 64095059 missense probably damaging 0.99
R6919:Prss51 UTSW 14 64097488 missense probably damaging 1.00
R7220:Prss51 UTSW 14 64095995 nonsense probably null
R7510:Prss51 UTSW 14 64096040 missense probably damaging 1.00
R7711:Prss51 UTSW 14 64097488 missense probably damaging 1.00
R7753:Prss51 UTSW 14 64095927 missense possibly damaging 0.86
R9000:Prss51 UTSW 14 64094971 missense possibly damaging 0.95
R9164:Prss51 UTSW 14 64097509 missense probably damaging 1.00
R9613:Prss51 UTSW 14 64095012 missense possibly damaging 0.65
X0024:Prss51 UTSW 14 64097466 missense probably damaging 1.00
Z1177:Prss51 UTSW 14 64094941 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTGTGGTCATGGGAATCAAG -3'
(R):5'- GACTTAACTGAGGGGCATTGC -3'

Sequencing Primer
(F):5'- GGTCATGGGAATCAAGACTTTC -3'
(R):5'- CTGTCGTTCTATGGATGGGAAAAG -3'
Posted On 2018-11-06