Mutagenetix > Incidental Mutation

Incidental Mutation 'R6908:Epha3'

538891

Institutional Source

Beutler Lab

Gene Symbol

Epha3

Ensembl Gene

ENSMUSG00000052504

Gene Name

Eph receptor A3

Synonyms

Tyro4, End3, Cek4, Hek, Hek4, Mek4

MMRRC Submission

Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63543534-63864175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 63598249 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 611 (H611P)

Ref Sequence

ENSEMBL: ENSMUSP00000066554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000064405
AA Change: H611P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: H611P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EPH_lbd	29	202	1.76e-127	SMART
Pfam:GCC2_GCC3	263	306	6.6e-9	PFAM
FN3	326	418	1.14e-5	SMART
FN3	437	518	4.8e-13	SMART
Pfam:EphA2_TM	543	619	8.2e-25	PFAM
TyrKc	622	879	5.16e-140	SMART
SAM	909	976	1.08e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000232049
AA Change: H610P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Epha3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Epha3	APN	16	63566684	missense	probably damaging	1.00
IGL01358:Epha3	APN	16	63595746	splice site	probably benign
IGL01713:Epha3	APN	16	63552562	missense	probably benign	0.00
IGL02371:Epha3	APN	16	63585020	critical splice acceptor site	probably null
IGL03111:Epha3	APN	16	63653446	missense	probably damaging	0.98
IGL03208:Epha3	APN	16	63611089	missense	probably damaging	1.00
laterality	UTSW	16	63568399	missense	probably damaging	1.00
midline	UTSW	16	63844144	missense	possibly damaging	0.46
stride	UTSW	16	63552494	missense	probably benign	0.00
F2404:Epha3	UTSW	16	63546168	missense	probably benign	0.14
P0041:Epha3	UTSW	16	63612868	missense	probably damaging	1.00
PIT4498001:Epha3	UTSW	16	63552526	missense	probably damaging	1.00
PIT4585001:Epha3	UTSW	16	63566577	critical splice donor site	probably null
R0147:Epha3	UTSW	16	63612944	missense	possibly damaging	0.89
R0148:Epha3	UTSW	16	63612944	missense	possibly damaging	0.89
R0336:Epha3	UTSW	16	63566648	missense	probably damaging	1.00
R0738:Epha3	UTSW	16	63595612	missense	probably damaging	1.00
R0833:Epha3	UTSW	16	63603519	splice site	probably benign
R0836:Epha3	UTSW	16	63603519	splice site	probably benign
R0969:Epha3	UTSW	16	63566636	missense	probably damaging	1.00
R1160:Epha3	UTSW	16	63773068	missense	probably damaging	1.00
R1205:Epha3	UTSW	16	63598248	frame shift	probably null
R1349:Epha3	UTSW	16	63611053	missense	possibly damaging	0.89
R1372:Epha3	UTSW	16	63611053	missense	possibly damaging	0.89
R1469:Epha3	UTSW	16	63653494	missense	probably damaging	0.97
R1469:Epha3	UTSW	16	63653494	missense	probably damaging	0.97
R1500:Epha3	UTSW	16	63595662	missense	probably benign	0.06
R1523:Epha3	UTSW	16	63610948	missense	probably damaging	0.99
R1532:Epha3	UTSW	16	63546178	missense	probably benign	0.08
R1544:Epha3	UTSW	16	63773053	missense	probably damaging	1.00
R1681:Epha3	UTSW	16	63595728	missense	probably damaging	1.00
R1708:Epha3	UTSW	16	63583507	missense	probably damaging	1.00
R1803:Epha3	UTSW	16	63602288	missense	probably benign	0.00
R1893:Epha3	UTSW	16	63568399	missense	probably damaging	1.00
R1957:Epha3	UTSW	16	63772952	missense	probably benign	0.00
R2144:Epha3	UTSW	16	63773317	missense	possibly damaging	0.86
R2190:Epha3	UTSW	16	63546189	missense	probably benign	0.05
R2198:Epha3	UTSW	16	63844144	missense	possibly damaging	0.46
R2344:Epha3	UTSW	16	63652383	missense	possibly damaging	0.67
R2504:Epha3	UTSW	16	63603625	missense	probably damaging	0.97
R2911:Epha3	UTSW	16	63652412	missense	probably benign
R3889:Epha3	UTSW	16	63610964	missense	probably damaging	1.00
R4223:Epha3	UTSW	16	63583539	missense	probably damaging	0.99
R4836:Epha3	UTSW	16	63583557	missense	probably damaging	1.00
R4981:Epha3	UTSW	16	63652412	missense	probably benign	0.04
R5044:Epha3	UTSW	16	63602287	missense	possibly damaging	0.79
R5195:Epha3	UTSW	16	63546147	missense	possibly damaging	0.86
R5248:Epha3	UTSW	16	63598257	missense	probably damaging	1.00
R5478:Epha3	UTSW	16	63583533	missense	probably damaging	1.00
R6052:Epha3	UTSW	16	63603604	missense	possibly damaging	0.94
R6167:Epha3	UTSW	16	63612924	missense	probably benign	0.00
R6337:Epha3	UTSW	16	63568443	missense	probably damaging	1.00
R6342:Epha3	UTSW	16	63583500	missense	probably damaging	1.00
R6793:Epha3	UTSW	16	63773455	missense	probably benign	0.01
R7029:Epha3	UTSW	16	63773335	missense	probably benign	0.37
R7059:Epha3	UTSW	16	63568455	missense	probably damaging	1.00
R7175:Epha3	UTSW	16	63583500	missense	probably damaging	1.00
R7204:Epha3	UTSW	16	63652332	missense	probably benign
R7217:Epha3	UTSW	16	63552494	missense	probably benign	0.00
R7315:Epha3	UTSW	16	63552609	missense	probably benign	0.00
R7389:Epha3	UTSW	16	63772984	missense	probably damaging	1.00
R7419:Epha3	UTSW	16	63598294	missense	probably damaging	1.00
R7572:Epha3	UTSW	16	63611080	nonsense	probably null
R7667:Epha3	UTSW	16	63566600	missense	probably benign	0.21
R7686:Epha3	UTSW	16	63773288	missense	probably damaging	1.00
R7855:Epha3	UTSW	16	63773560	missense	probably damaging	1.00
R8085:Epha3	UTSW	16	63583510	missense	probably damaging	1.00
R8167:Epha3	UTSW	16	63568441	missense	probably damaging	1.00
R8260:Epha3	UTSW	16	63583554	missense	probably damaging	1.00
R8290:Epha3	UTSW	16	63652496	missense	possibly damaging	0.94
R8298:Epha3	UTSW	16	63566598	missense	probably benign	0.16
R8350:Epha3	UTSW	16	63652490	missense	possibly damaging	0.91
R8450:Epha3	UTSW	16	63652490	missense	possibly damaging	0.91
R8470:Epha3	UTSW	16	63844147	missense	probably benign	0.00
R8478:Epha3	UTSW	16	63773081	missense	probably damaging	1.00
R8724:Epha3	UTSW	16	63583455	missense	probably damaging	1.00
R8862:Epha3	UTSW	16	63610985	missense	probably benign
R8921:Epha3	UTSW	16	63652475	missense	possibly damaging	0.81
R9519:Epha3	UTSW	16	63652305	missense	possibly damaging	0.77
R9563:Epha3	UTSW	16	63546147	missense	possibly damaging	0.86
R9795:Epha3	UTSW	16	63552547	missense	probably benign	0.00
Z1176:Epha3	UTSW	16	63585012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTGTAAGTCTGGCACCTTTG -3'
(R):5'- CAGAGTAGCCTACAGATCGATAC -3'

Sequencing Primer
(F):5'- GCCTGTCTTTGATCATGAAATCAG -3'
(R):5'- GCCTACAGATCGATACAAATTAGTG -3'

Posted On

2018-11-06