Incidental Mutation 'R6908:Epha3'
ID 538891
Institutional Source Beutler Lab
Gene Symbol Epha3
Ensembl Gene ENSMUSG00000052504
Gene Name Eph receptor A3
Synonyms Tyro4, End3, Cek4, Hek, Hek4, Mek4
MMRRC Submission
Accession Numbers

Genbank: NM_010140; MGI: 99612

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 63543534-63864175 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63598249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 611 (H611P)
Ref Sequence ENSEMBL: ENSMUSP00000066554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064405] [ENSMUST00000232049]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064405
AA Change: H611P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066554
Gene: ENSMUSG00000052504
AA Change: H611P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EPH_lbd 29 202 1.76e-127 SMART
Pfam:GCC2_GCC3 263 306 6.6e-9 PFAM
FN3 326 418 1.14e-5 SMART
FN3 437 518 4.8e-13 SMART
Pfam:EphA2_TM 543 619 8.2e-25 PFAM
TyrKc 622 879 5.16e-140 SMART
SAM 909 976 1.08e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232049
AA Change: H610P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 48 hours of birth of cardiac failure. Survivors develop normally with no indications of cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Epha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Epha3 APN 16 63566684 missense probably damaging 1.00
IGL01358:Epha3 APN 16 63595746 splice site probably benign
IGL01713:Epha3 APN 16 63552562 missense probably benign 0.00
IGL02371:Epha3 APN 16 63585020 critical splice acceptor site probably null
IGL03111:Epha3 APN 16 63653446 missense probably damaging 0.98
IGL03208:Epha3 APN 16 63611089 missense probably damaging 1.00
laterality UTSW 16 63568399 missense probably damaging 1.00
midline UTSW 16 63844144 missense possibly damaging 0.46
stride UTSW 16 63552494 missense probably benign 0.00
F2404:Epha3 UTSW 16 63546168 missense probably benign 0.14
P0041:Epha3 UTSW 16 63612868 missense probably damaging 1.00
PIT4498001:Epha3 UTSW 16 63552526 missense probably damaging 1.00
PIT4585001:Epha3 UTSW 16 63566577 critical splice donor site probably null
R0147:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0148:Epha3 UTSW 16 63612944 missense possibly damaging 0.89
R0336:Epha3 UTSW 16 63566648 missense probably damaging 1.00
R0738:Epha3 UTSW 16 63595612 missense probably damaging 1.00
R0833:Epha3 UTSW 16 63603519 splice site probably benign
R0836:Epha3 UTSW 16 63603519 splice site probably benign
R0969:Epha3 UTSW 16 63566636 missense probably damaging 1.00
R1160:Epha3 UTSW 16 63773068 missense probably damaging 1.00
R1205:Epha3 UTSW 16 63598248 frame shift probably null
R1349:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1372:Epha3 UTSW 16 63611053 missense possibly damaging 0.89
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1469:Epha3 UTSW 16 63653494 missense probably damaging 0.97
R1500:Epha3 UTSW 16 63595662 missense probably benign 0.06
R1523:Epha3 UTSW 16 63610948 missense probably damaging 0.99
R1532:Epha3 UTSW 16 63546178 missense probably benign 0.08
R1544:Epha3 UTSW 16 63773053 missense probably damaging 1.00
R1681:Epha3 UTSW 16 63595728 missense probably damaging 1.00
R1708:Epha3 UTSW 16 63583507 missense probably damaging 1.00
R1803:Epha3 UTSW 16 63602288 missense probably benign 0.00
R1893:Epha3 UTSW 16 63568399 missense probably damaging 1.00
R1957:Epha3 UTSW 16 63772952 missense probably benign 0.00
R2144:Epha3 UTSW 16 63773317 missense possibly damaging 0.86
R2190:Epha3 UTSW 16 63546189 missense probably benign 0.05
R2198:Epha3 UTSW 16 63844144 missense possibly damaging 0.46
R2344:Epha3 UTSW 16 63652383 missense possibly damaging 0.67
R2504:Epha3 UTSW 16 63603625 missense probably damaging 0.97
R2911:Epha3 UTSW 16 63652412 missense probably benign
R3889:Epha3 UTSW 16 63610964 missense probably damaging 1.00
R4223:Epha3 UTSW 16 63583539 missense probably damaging 0.99
R4836:Epha3 UTSW 16 63583557 missense probably damaging 1.00
R4981:Epha3 UTSW 16 63652412 missense probably benign 0.04
R5044:Epha3 UTSW 16 63602287 missense possibly damaging 0.79
R5195:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R5248:Epha3 UTSW 16 63598257 missense probably damaging 1.00
R5478:Epha3 UTSW 16 63583533 missense probably damaging 1.00
R6052:Epha3 UTSW 16 63603604 missense possibly damaging 0.94
R6167:Epha3 UTSW 16 63612924 missense probably benign 0.00
R6337:Epha3 UTSW 16 63568443 missense probably damaging 1.00
R6342:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R6793:Epha3 UTSW 16 63773455 missense probably benign 0.01
R7029:Epha3 UTSW 16 63773335 missense probably benign 0.37
R7059:Epha3 UTSW 16 63568455 missense probably damaging 1.00
R7175:Epha3 UTSW 16 63583500 missense probably damaging 1.00
R7204:Epha3 UTSW 16 63652332 missense probably benign
R7217:Epha3 UTSW 16 63552494 missense probably benign 0.00
R7315:Epha3 UTSW 16 63552609 missense probably benign 0.00
R7389:Epha3 UTSW 16 63772984 missense probably damaging 1.00
R7419:Epha3 UTSW 16 63598294 missense probably damaging 1.00
R7572:Epha3 UTSW 16 63611080 nonsense probably null
R7667:Epha3 UTSW 16 63566600 missense probably benign 0.21
R7686:Epha3 UTSW 16 63773288 missense probably damaging 1.00
R7855:Epha3 UTSW 16 63773560 missense probably damaging 1.00
R8085:Epha3 UTSW 16 63583510 missense probably damaging 1.00
R8167:Epha3 UTSW 16 63568441 missense probably damaging 1.00
R8260:Epha3 UTSW 16 63583554 missense probably damaging 1.00
R8290:Epha3 UTSW 16 63652496 missense possibly damaging 0.94
R8298:Epha3 UTSW 16 63566598 missense probably benign 0.16
R8350:Epha3 UTSW 16 63652490 missense possibly damaging 0.91
R8450:Epha3 UTSW 16 63652490 missense possibly damaging 0.91
R8470:Epha3 UTSW 16 63844147 missense probably benign 0.00
R8478:Epha3 UTSW 16 63773081 missense probably damaging 1.00
R8724:Epha3 UTSW 16 63583455 missense probably damaging 1.00
R8862:Epha3 UTSW 16 63610985 missense probably benign
R8921:Epha3 UTSW 16 63652475 missense possibly damaging 0.81
R9519:Epha3 UTSW 16 63652305 missense possibly damaging 0.77
R9563:Epha3 UTSW 16 63546147 missense possibly damaging 0.86
R9795:Epha3 UTSW 16 63552547 missense probably benign 0.00
Z1176:Epha3 UTSW 16 63585012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTAAGTCTGGCACCTTTG -3'
(R):5'- CAGAGTAGCCTACAGATCGATAC -3'

Sequencing Primer
(F):5'- GCCTGTCTTTGATCATGAAATCAG -3'
(R):5'- GCCTACAGATCGATACAAATTAGTG -3'
Posted On 2018-11-06