Incidental Mutation 'R6908:Cxxc5'
ID 538893
Institutional Source Beutler Lab
Gene Symbol Cxxc5
Ensembl Gene ENSMUSG00000046668
Gene Name CXXC finger 5
Synonyms 4930415K17Rik
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.482) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 35962450-35994741 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35992268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 223 (V223A)
Ref Sequence ENSEMBL: ENSMUSP00000054307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060722]
AlphaFold Q91WA4
Predicted Effect probably damaging
Transcript: ENSMUST00000060722
AA Change: V223A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054307
Gene: ENSMUSG00000046668
AA Change: V223A

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 82 95 N/A INTRINSIC
low complexity region 98 111 N/A INTRINSIC
Pfam:zf-CXXC 250 291 3.4e-10 PFAM
Meta Mutation Damage Score 0.3490 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a retinoid-inducible nuclear protein containing a CXXC-type zinc finger motif. The encoded protein is involved in myelopoiesis, is required for DNA damage-induced p53 activation, regulates the differentiation of C2C12 myoblasts into myocytes, and negatively regulates cutaneous wound healing. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in bone mass, bone mineral density, osteocyte dendrite formation, and bone formation rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Cxxc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cxxc5 APN 18 35,993,745 (GRCm39) makesense probably null
R0625:Cxxc5 UTSW 18 35,991,642 (GRCm39) missense unknown
R1538:Cxxc5 UTSW 18 35,991,622 (GRCm39) missense unknown
R1891:Cxxc5 UTSW 18 35,992,318 (GRCm39) missense possibly damaging 0.77
R5812:Cxxc5 UTSW 18 35,992,109 (GRCm39) missense probably damaging 0.98
R6622:Cxxc5 UTSW 18 35,992,372 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATGCTAAAGCGCGTGGTG -3'
(R):5'- TGCTGTTACCTCCAGAGCAG -3'

Sequencing Primer
(F):5'- GCGTGGTGCAGGAACAC -3'
(R):5'- TGCAAATCTGATGGCCAGTC -3'
Posted On 2018-11-06