Mutagenetix > Incidental Mutations

Incidental Mutation 'R6908:Cxxc1'

538895

Institutional Source

Beutler Lab

Gene Symbol

Cxxc1

Ensembl Gene

ENSMUSG00000024560

Gene Name

CXXC finger 1 (PHD domain)

Synonyms

2410002I16Rik, 5830420C16Rik, PHF18, Cgbp, Cfp1

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_028868.3; MGI:1921572

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74216131-74221491 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74220559 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 546 (C546Y)

Ref Sequence

ENSEMBL: ENSMUSP00000025444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025444]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025444
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025444
Gene: ENSMUSG00000024560
AA Change: C546Y

Domain	Start	End	E-Value	Type
PHD	28	74	1.26e-10	SMART
Pfam:zf-CXXC	164	212	2.4e-19	PFAM
low complexity region	237	253	N/A	INTRINSIC
low complexity region	272	282	N/A	INTRINSIC
low complexity region	325	364	N/A	INTRINSIC
Pfam:zf-CpG_bind_C	404	640	2.1e-108	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

Strain: 2654854
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit peri-implantation lethality and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Sorbs1	A	G	19: 40,352,332	S455P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Cxxc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01477:Cxxc1	APN	18	74219914	missense	possibly damaging	0.83
IGL02250:Cxxc1	APN	18	74219169	missense	probably benign	0.00
IGL02640:Cxxc1	APN	18	74221183	missense	probably damaging	1.00
IGL02802:Cxxc1	UTSW	18	74219410	nonsense	probably null
P0018:Cxxc1	UTSW	18	74220921	missense	probably damaging	1.00
R0534:Cxxc1	UTSW	18	74218891	missense	probably benign	0.00
R0557:Cxxc1	UTSW	18	74218774	missense	possibly damaging	0.92
R0576:Cxxc1	UTSW	18	74220185	missense	possibly damaging	0.47
R0673:Cxxc1	UTSW	18	74218913	missense	possibly damaging	0.92
R1539:Cxxc1	UTSW	18	74219207	missense	possibly damaging	0.53
R1714:Cxxc1	UTSW	18	74219863	missense	probably damaging	1.00
R4763:Cxxc1	UTSW	18	74219413	missense	probably damaging	0.98
R5252:Cxxc1	UTSW	18	74219951	missense	probably benign	0.30
R5890:Cxxc1	UTSW	18	74221166	missense	possibly damaging	0.68
R7064:Cxxc1	UTSW	18	74220607	critical splice donor site	probably null
R7305:Cxxc1	UTSW	18	74219396	missense	probably benign	0.02
R7404:Cxxc1	UTSW	18	74219207	missense	possibly damaging	0.95
R7790:Cxxc1	UTSW	18	74217784	missense	probably damaging	0.99
T0975:Cxxc1	UTSW	18	74220921	missense	probably damaging	1.00
X0028:Cxxc1	UTSW	18	74218801	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTGGGTCCATGTACCCCAC -3'
(R):5'- AGACACCAAGAGTCGGTGTG -3'

Sequencing Primer
(F):5'- TGTACCCCACACGCATCGAG -3'
(R):5'- CACCAAGAGTCGGTGTGGCTAG -3'

Posted On

2018-11-06