Incidental Mutation 'R6908:Cxxc1'
ID538895
Institutional Source Beutler Lab
Gene Symbol Cxxc1
Ensembl Gene ENSMUSG00000024560
Gene NameCXXC finger 1 (PHD domain)
Synonyms2410002I16Rik, 5830420C16Rik, PHF18, Cgbp, Cfp1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028868.3; MGI:1921572

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6908 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74216131-74221491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74220559 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 546 (C546Y)
Ref Sequence ENSEMBL: ENSMUSP00000025444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025444]
Predicted Effect probably damaging
Transcript: ENSMUST00000025444
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025444
Gene: ENSMUSG00000024560
AA Change: C546Y

DomainStartEndE-ValueType
PHD 28 74 1.26e-10 SMART
Pfam:zf-CXXC 164 212 2.4e-19 PFAM
low complexity region 237 253 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
low complexity region 325 364 N/A INTRINSIC
Pfam:zf-CpG_bind_C 404 640 2.1e-108 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype Strain: 2654854
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit peri-implantation lethality and failure to gastrulate. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)
 

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Cxxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Cxxc1 APN 18 74219914 missense possibly damaging 0.83
IGL02250:Cxxc1 APN 18 74219169 missense probably benign 0.00
IGL02640:Cxxc1 APN 18 74221183 missense probably damaging 1.00
IGL02802:Cxxc1 UTSW 18 74219410 nonsense probably null
P0018:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
R0534:Cxxc1 UTSW 18 74218891 missense probably benign 0.00
R0557:Cxxc1 UTSW 18 74218774 missense possibly damaging 0.92
R0576:Cxxc1 UTSW 18 74220185 missense possibly damaging 0.47
R0673:Cxxc1 UTSW 18 74218913 missense possibly damaging 0.92
R1539:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.53
R1714:Cxxc1 UTSW 18 74219863 missense probably damaging 1.00
R4763:Cxxc1 UTSW 18 74219413 missense probably damaging 0.98
R5252:Cxxc1 UTSW 18 74219951 missense probably benign 0.30
R5890:Cxxc1 UTSW 18 74221166 missense possibly damaging 0.68
R7064:Cxxc1 UTSW 18 74220607 critical splice donor site probably null
R7305:Cxxc1 UTSW 18 74219396 missense probably benign 0.02
R7404:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.95
R7790:Cxxc1 UTSW 18 74217784 missense probably damaging 0.99
T0975:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
X0028:Cxxc1 UTSW 18 74218801 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGGTCCATGTACCCCAC -3'
(R):5'- AGACACCAAGAGTCGGTGTG -3'

Sequencing Primer
(F):5'- TGTACCCCACACGCATCGAG -3'
(R):5'- CACCAAGAGTCGGTGTGGCTAG -3'
Posted On2018-11-06