Incidental Mutation 'R6908:Sorbs1'
ID 538898
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Name sorbin and SH3 domain containing 1
Synonyms c-Cbl-associated protein, Ponsin, CAP, 2310065E01Rik, 9530001P15Rik, Sh3d5
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.815) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40283197-40502223 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40340776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 455 (S455P)
Ref Sequence ENSEMBL: ENSMUSP00000153313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000099466
AA Change: S285P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006
AA Change: S285P

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099467
AA Change: S455P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: S455P

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165212
AA Change: S275P

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006
AA Change: S275P

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165469
AA Change: S315P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006
AA Change: S315P

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224247
AA Change: S285P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000224583
Predicted Effect probably damaging
Transcript: ENSMUST00000224667
AA Change: S284P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225148
AA Change: S285P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225153
AA Change: S455P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225786
AA Change: S315P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226047
AA Change: S296P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4949 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Pkd2l1 A G 19: 44,140,885 (GRCm39) I559T probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40,306,473 (GRCm39) missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40,332,795 (GRCm39) splice site probably null
IGL00788:Sorbs1 APN 19 40,325,487 (GRCm39) splice site probably benign
IGL00943:Sorbs1 APN 19 40,283,484 (GRCm39) utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40,338,422 (GRCm39) missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40,365,091 (GRCm39) missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40,306,460 (GRCm39) splice site probably benign
IGL02159:Sorbs1 APN 19 40,316,040 (GRCm39) missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40,302,841 (GRCm39) missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40,315,991 (GRCm39) missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40,353,577 (GRCm39) missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40,303,125 (GRCm39) missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40,365,348 (GRCm39) missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40,365,187 (GRCm39) missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40,302,820 (GRCm39) missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40,351,706 (GRCm39) missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40,332,858 (GRCm39) missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40,362,009 (GRCm39) missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0016:Sorbs1 UTSW 19 40,303,182 (GRCm39) splice site probably benign
R0306:Sorbs1 UTSW 19 40,332,855 (GRCm39) missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40,338,392 (GRCm39) missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40,300,260 (GRCm39) missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40,351,706 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40,371,050 (GRCm39) missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40,381,904 (GRCm39) missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40,353,472 (GRCm39) splice site probably null
R2148:Sorbs1 UTSW 19 40,365,268 (GRCm39) missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40,285,075 (GRCm39) missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40,361,959 (GRCm39) missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40,362,015 (GRCm39) missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40,302,887 (GRCm39) missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40,384,189 (GRCm39) missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40,300,294 (GRCm39) missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40,361,962 (GRCm39) missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40,303,133 (GRCm39) missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40,325,449 (GRCm39) missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40,328,491 (GRCm39) nonsense probably null
R4912:Sorbs1 UTSW 19 40,300,171 (GRCm39) missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40,329,151 (GRCm39) missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40,310,334 (GRCm39) missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40,365,433 (GRCm39) missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40,365,325 (GRCm39) missense probably benign
R5871:Sorbs1 UTSW 19 40,387,027 (GRCm39) missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40,313,216 (GRCm39) missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40,303,101 (GRCm39) missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40,310,263 (GRCm39) missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40,365,426 (GRCm39) critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40,314,496 (GRCm39) missense probably benign
R6646:Sorbs1 UTSW 19 40,313,993 (GRCm39) missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40,315,991 (GRCm39) missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6850:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6878:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6879:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6880:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R6980:Sorbs1 UTSW 19 40,316,060 (GRCm39) nonsense probably null
R7040:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7041:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7110:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7122:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7170:Sorbs1 UTSW 19 40,314,573 (GRCm39) nonsense probably null
R7180:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7185:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7187:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7254:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7255:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7401:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7595:Sorbs1 UTSW 19 40,303,097 (GRCm39) missense probably damaging 0.99
R7819:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R7876:Sorbs1 UTSW 19 40,285,032 (GRCm39) missense probably damaging 1.00
R7894:Sorbs1 UTSW 19 40,316,020 (GRCm39) missense probably benign 0.02
R7986:Sorbs1 UTSW 19 40,353,449 (GRCm39) missense probably damaging 0.99
R8031:Sorbs1 UTSW 19 40,314,933 (GRCm39) missense probably benign 0.17
R8082:Sorbs1 UTSW 19 40,353,527 (GRCm39) missense probably benign 0.08
R8282:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8283:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8446:Sorbs1 UTSW 19 40,314,602 (GRCm39) missense probably benign
R8526:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8527:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8528:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8539:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8540:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8542:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8543:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8544:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8545:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8684:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8699:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8702:Sorbs1 UTSW 19 40,365,244 (GRCm39) missense probably benign
R8752:Sorbs1 UTSW 19 40,349,872 (GRCm39) critical splice donor site probably null
R8937:Sorbs1 UTSW 19 40,362,006 (GRCm39) missense probably benign 0.02
R8956:Sorbs1 UTSW 19 40,351,660 (GRCm39) missense probably damaging 1.00
R8960:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9175:Sorbs1 UTSW 19 40,315,018 (GRCm39) missense probably damaging 1.00
R9208:Sorbs1 UTSW 19 40,353,462 (GRCm39) start gained probably benign
R9211:Sorbs1 UTSW 19 40,332,798 (GRCm39) critical splice donor site probably null
R9371:Sorbs1 UTSW 19 40,315,324 (GRCm39) missense probably damaging 0.98
R9374:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9377:Sorbs1 UTSW 19 40,387,048 (GRCm39) missense probably damaging 0.98
R9551:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9552:Sorbs1 UTSW 19 40,361,923 (GRCm39) nonsense probably null
R9686:Sorbs1 UTSW 19 40,381,954 (GRCm39) missense probably damaging 1.00
Z1177:Sorbs1 UTSW 19 40,315,339 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGACTTCATCCTCAGTTCACAG -3'
(R):5'- TAAGTGACAAAAGCCCCTGC -3'

Sequencing Primer
(F):5'- AGACTCAGATTAAGTCGCTGCTGC -3'
(R):5'- CCTGCTTGTCGGGGAGGAAG -3'
Posted On 2018-11-06