Mutagenetix > Incidental Mutation

Incidental Mutation 'R6908:Sorbs1'

538898

Institutional Source

Beutler Lab

Gene Symbol

Sorbs1

Ensembl Gene

ENSMUSG00000025006

Gene Name

sorbin and SH3 domain containing 1

Synonyms

9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.686) question?

Stock #

R6908 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40294753-40513779 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 40352332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 455 (S455P)

Ref Sequence

ENSEMBL: ENSMUSP00000153313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224583] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000099466
AA Change: S285P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006
AA Change: S285P

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	203	249	1.07e-26	SMART
SH3	502	557	2.72e-18	SMART
SH3	576	633	9.32e-17	SMART
low complexity region	647	660	N/A	INTRINSIC
SH3	682	739	3.7e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000099467
AA Change: S455P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: S455P

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
low complexity region	192	213	N/A	INTRINSIC
Sorb	327	373	1.24e-22	SMART
coiled coil region	558	584	N/A	INTRINSIC
SH3	700	755	2.72e-18	SMART
SH3	774	831	9.32e-17	SMART
low complexity region	845	858	N/A	INTRINSIC
SH3	880	937	3.7e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165212
AA Change: S275P

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006
AA Change: S275P

Domain	Start	End	E-Value	Type
low complexity region	45	63	N/A	INTRINSIC
Sorb	193	239	1.07e-26	SMART
SH3	486	541	2.72e-18	SMART
SH3	560	617	9.32e-17	SMART
low complexity region	631	644	N/A	INTRINSIC
SH3	666	723	3.7e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165469
AA Change: S315P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006
AA Change: S315P

Domain	Start	End	E-Value	Type
low complexity region	75	93	N/A	INTRINSIC
Sorb	233	279	1.07e-26	SMART
SH3	476	531	2.72e-18	SMART
SH3	550	607	9.32e-17	SMART
low complexity region	621	634	N/A	INTRINSIC
SH3	656	713	3.7e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000224247
AA Change: S285P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000224583

Predicted Effect

probably damaging
Transcript: ENSMUST00000224667
AA Change: S284P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225148
AA Change: S285P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225153
AA Change: S455P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225786
AA Change: S315P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000226047
AA Change: S296P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.4949

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	C	16: 56,657,305	I1197T	probably benign	Het
Atp2a1	A	G	7: 126,448,535		probably null	Het
B3glct	T	C	5: 149,696,476		probably null	Het
Bbs9	T	G	9: 22,567,723	I154S	probably damaging	Het
Brip1	T	C	11: 86,077,884	Y825C	probably damaging	Het
Ccdc186	A	T	19: 56,791,939		probably null	Het
Celf6	T	C	9: 59,603,823	V349A	probably benign	Het
Chd9	A	G	8: 90,956,416	T495A	probably benign	Het
Cxxc1	G	A	18: 74,220,559	C546Y	probably damaging	Het
Cxxc5	T	C	18: 35,859,215	V223A	probably damaging	Het
Dlc1	A	G	8: 36,937,687	F316S	probably benign	Het
Dnajc12	C	A	10: 63,397,325	Q82K	probably benign	Het
Dock8	G	A	19: 25,188,382	E1877K	probably damaging	Het
Epha3	T	G	16: 63,598,249	H611P	probably damaging	Het
Fpr-rs6	C	A	17: 20,182,439	C220F	probably damaging	Het
Fryl	A	G	5: 73,022,211	L2951P	probably damaging	Het
Gbp10	T	G	5: 105,221,032	T314P	probably damaging	Het
Hbb-bs	T	C	7: 103,827,534	N77D	probably benign	Het
Ints13	A	T	6: 146,555,033	D438E	probably damaging	Het
Itgb6	C	T	2: 60,650,021	V324M	probably benign	Het
Kdm7a	G	T	6: 39,144,439	L861M	possibly damaging	Het
Kirrel3	A	G	9: 35,013,401	T302A	possibly damaging	Het
Lama2	A	T	10: 27,031,196		probably null	Het
Lrp2	A	T	2: 69,472,365	C3007S	probably damaging	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Mastl	T	C	2: 23,155,976		probably benign	Het
Mcf2l	T	C	8: 13,018,919	V1087A	probably benign	Het
Mcmdc2	C	A	1: 9,930,778		probably null	Het
Ms4a3	A	G	19: 11,638,295	I39T	probably damaging	Het
Mylk	T	G	16: 34,880,273	C495G	probably benign	Het
Myo10	A	G	15: 25,804,383	D1588G	probably damaging	Het
Myo15	A	T	11: 60,506,006	T2634S	probably damaging	Het
Nlrp1b	T	C	11: 71,217,296	I460V	probably benign	Het
Nmt1	T	G	11: 103,058,254	S312A	possibly damaging	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr710	T	C	7: 106,944,632	Y123C	possibly damaging	Het
Paxip1	T	C	5: 27,791,224	Y19C	possibly damaging	Het
Pcdhb2	G	T	18: 37,296,524	A517S	probably damaging	Het
Pkd2l1	A	G	19: 44,152,446	I559T	probably damaging	Het
Plec	G	A	15: 76,185,881	Q806*	probably null	Het
Prss51	C	T	14: 64,096,152	A70V	probably benign	Het
Psd3	A	T	8: 67,964,177	I356K	probably benign	Het
Ptprn2	A	T	12: 116,888,888	I522F	probably benign	Het
Rab39	T	C	9: 53,706,069	D16G	probably damaging	Het
Ralgps1	T	C	2: 33,143,100	Q439R	probably benign	Het
Rapgef2	A	T	3: 79,104,063	D238E	probably benign	Het
Ripor2	G	A	13: 24,706,232	G697S	probably damaging	Het
Scn11a	A	T	9: 119,792,426	F642I	probably damaging	Het
Serinc4	G	A	2: 121,453,605	T310I	probably benign	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Slc36a3	T	C	11: 55,149,886		probably benign	Het
Smc1b	A	G	15: 85,107,010	S656P	probably damaging	Het
Ttn	C	A	2: 76,889,858		probably benign	Het
Tyw5	T	C	1: 57,401,523	R27G	probably damaging	Het
Vmn1r209	T	C	13: 22,806,230	T97A	possibly damaging	Het

Other mutations in Sorbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sorbs1	APN	19	40318029	missense	probably damaging	1.00
IGL00776:Sorbs1	APN	19	40344351	splice site	probably null
IGL00788:Sorbs1	APN	19	40337043	splice site	probably benign
IGL00943:Sorbs1	APN	19	40295040	utr 3 prime	probably benign
IGL01525:Sorbs1	APN	19	40349978	missense	probably damaging	1.00
IGL01530:Sorbs1	APN	19	40376647	missense	probably benign	0.01
IGL01951:Sorbs1	APN	19	40318016	splice site	probably benign
IGL02159:Sorbs1	APN	19	40327596	missense	probably damaging	0.96
IGL02252:Sorbs1	APN	19	40314397	missense	probably damaging	1.00
IGL02613:Sorbs1	APN	19	40327547	missense	probably damaging	1.00
IGL02643:Sorbs1	APN	19	40365133	missense	possibly damaging	0.65
IGL02668:Sorbs1	APN	19	40314681	missense	probably damaging	1.00
IGL02738:Sorbs1	APN	19	40376904	missense	probably damaging	0.97
IGL02965:Sorbs1	APN	19	40376743	missense	probably benign	0.01
IGL03083:Sorbs1	APN	19	40314376	missense	probably damaging	1.00
IGL03173:Sorbs1	APN	19	40363262	missense	probably damaging	1.00
IGL03286:Sorbs1	APN	19	40344414	missense	probably damaging	0.99
IGL03292:Sorbs1	APN	19	40373565	missense	possibly damaging	0.79
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0016:Sorbs1	UTSW	19	40314738	splice site	probably benign
R0306:Sorbs1	UTSW	19	40344411	missense	possibly damaging	0.94
R0526:Sorbs1	UTSW	19	40349948	missense	probably damaging	1.00
R0551:Sorbs1	UTSW	19	40311816	missense	probably damaging	1.00
R0688:Sorbs1	UTSW	19	40363262	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1185:Sorbs1	UTSW	19	40382606	missense	probably damaging	1.00
R1891:Sorbs1	UTSW	19	40393460	missense	probably damaging	0.99
R2066:Sorbs1	UTSW	19	40365028	splice site	probably null
R2148:Sorbs1	UTSW	19	40376824	missense	possibly damaging	0.94
R2214:Sorbs1	UTSW	19	40296631	missense	probably damaging	1.00
R2410:Sorbs1	UTSW	19	40373515	missense	probably damaging	0.99
R2940:Sorbs1	UTSW	19	40373571	missense	probably damaging	1.00
R3847:Sorbs1	UTSW	19	40314443	missense	probably damaging	0.97
R4405:Sorbs1	UTSW	19	40395745	missense	probably benign	0.03
R4544:Sorbs1	UTSW	19	40311850	missense	probably damaging	0.99
R4618:Sorbs1	UTSW	19	40373518	missense	probably damaging	0.99
R4731:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4732:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4733:Sorbs1	UTSW	19	40314689	missense	probably benign	0.29
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4860:Sorbs1	UTSW	19	40337005	missense	probably benign	0.44
R4907:Sorbs1	UTSW	19	40340047	nonsense	probably null
R4912:Sorbs1	UTSW	19	40311727	missense	probably damaging	1.00
R5229:Sorbs1	UTSW	19	40340707	missense	probably damaging	1.00
R5285:Sorbs1	UTSW	19	40321890	missense	probably damaging	1.00
R5416:Sorbs1	UTSW	19	40376989	missense	probably benign	0.06
R5706:Sorbs1	UTSW	19	40376881	missense	probably benign
R5871:Sorbs1	UTSW	19	40398583	missense	probably damaging	1.00
R5936:Sorbs1	UTSW	19	40324772	missense	probably damaging	0.96
R6073:Sorbs1	UTSW	19	40314657	missense	probably damaging	1.00
R6324:Sorbs1	UTSW	19	40321819	missense	probably damaging	0.99
R6343:Sorbs1	UTSW	19	40376982	critical splice donor site	probably null
R6561:Sorbs1	UTSW	19	40326052	missense	probably benign
R6646:Sorbs1	UTSW	19	40325549	missense	probably damaging	1.00
R6768:Sorbs1	UTSW	19	40327547	missense	probably damaging	1.00
R6849:Sorbs1	UTSW	19	40376800	missense	probably benign
R6850:Sorbs1	UTSW	19	40376800	missense	probably benign
R6878:Sorbs1	UTSW	19	40376800	missense	probably benign
R6879:Sorbs1	UTSW	19	40376800	missense	probably benign
R6880:Sorbs1	UTSW	19	40376800	missense	probably benign
R6980:Sorbs1	UTSW	19	40327616	nonsense	probably null
R7040:Sorbs1	UTSW	19	40376800	missense	probably benign
R7041:Sorbs1	UTSW	19	40376800	missense	probably benign
R7110:Sorbs1	UTSW	19	40376800	missense	probably benign
R7122:Sorbs1	UTSW	19	40376800	missense	probably benign
R7170:Sorbs1	UTSW	19	40326129	nonsense	probably null
R7180:Sorbs1	UTSW	19	40376800	missense	probably benign
R7185:Sorbs1	UTSW	19	40376800	missense	probably benign
R7187:Sorbs1	UTSW	19	40376800	missense	probably benign
R7254:Sorbs1	UTSW	19	40376800	missense	probably benign
R7255:Sorbs1	UTSW	19	40376800	missense	probably benign
R7401:Sorbs1	UTSW	19	40376800	missense	probably benign
R7595:Sorbs1	UTSW	19	40314653	missense	probably damaging	0.99
R7819:Sorbs1	UTSW	19	40376800	missense	probably benign
R7876:Sorbs1	UTSW	19	40296588	missense	probably damaging	1.00
R7894:Sorbs1	UTSW	19	40327576	missense	probably benign	0.02
R7986:Sorbs1	UTSW	19	40365005	missense	probably damaging	0.99
R8031:Sorbs1	UTSW	19	40326489	missense	probably benign	0.17
R8082:Sorbs1	UTSW	19	40365083	missense	probably benign	0.08
R8282:Sorbs1	UTSW	19	40376800	missense	probably benign
R8283:Sorbs1	UTSW	19	40376800	missense	probably benign
R8446:Sorbs1	UTSW	19	40326158	missense	probably benign
R8526:Sorbs1	UTSW	19	40376800	missense	probably benign
R8527:Sorbs1	UTSW	19	40376800	missense	probably benign
R8528:Sorbs1	UTSW	19	40376800	missense	probably benign
R8539:Sorbs1	UTSW	19	40376800	missense	probably benign
R8540:Sorbs1	UTSW	19	40376800	missense	probably benign
R8542:Sorbs1	UTSW	19	40376800	missense	probably benign
R8543:Sorbs1	UTSW	19	40376800	missense	probably benign
R8544:Sorbs1	UTSW	19	40376800	missense	probably benign
R8545:Sorbs1	UTSW	19	40376800	missense	probably benign
R8684:Sorbs1	UTSW	19	40376800	missense	probably benign
R8699:Sorbs1	UTSW	19	40376800	missense	probably benign
R8702:Sorbs1	UTSW	19	40376800	missense	probably benign
R8752:Sorbs1	UTSW	19	40361428	critical splice donor site	probably null
R8937:Sorbs1	UTSW	19	40373562	missense	probably benign	0.02
R8956:Sorbs1	UTSW	19	40363216	missense	probably damaging	1.00
R8960:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9175:Sorbs1	UTSW	19	40326574	missense	probably damaging	1.00
R9208:Sorbs1	UTSW	19	40365018	start gained	probably benign
R9211:Sorbs1	UTSW	19	40344354	critical splice donor site	probably null
R9371:Sorbs1	UTSW	19	40326880	missense	probably damaging	0.98
R9374:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9377:Sorbs1	UTSW	19	40398604	missense	probably damaging	0.98
R9551:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9552:Sorbs1	UTSW	19	40373479	nonsense	probably null
R9686:Sorbs1	UTSW	19	40393510	missense	probably damaging	1.00
Z1177:Sorbs1	UTSW	19	40326895	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTGACTTCATCCTCAGTTCACAG -3'
(R):5'- TAAGTGACAAAAGCCCCTGC -3'

Sequencing Primer
(F):5'- AGACTCAGATTAAGTCGCTGCTGC -3'
(R):5'- CCTGCTTGTCGGGGAGGAAG -3'

Posted On

2018-11-06