Incidental Mutation 'R6908:Pkd2l1'
ID 538899
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Name polycystic kidney disease 2-like 1
Synonyms PKD2L, polycystin-L, PCL, TRPP3, Pkdl
MMRRC Submission 045000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 44136076-44180881 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44140885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 559 (I559T)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
AlphaFold A2A259
Predicted Effect probably damaging
Transcript: ENSMUST00000042026
AA Change: I559T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: I559T

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Meta Mutation Damage Score 0.6228 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,477,668 (GRCm39) I1197T probably benign Het
Atp2a1 A G 7: 126,047,707 (GRCm39) probably null Het
B3glct T C 5: 149,619,941 (GRCm39) probably null Het
Bbs9 T G 9: 22,479,019 (GRCm39) I154S probably damaging Het
Brip1 T C 11: 85,968,710 (GRCm39) Y825C probably damaging Het
Ccdc186 A T 19: 56,780,371 (GRCm39) probably null Het
Celf6 T C 9: 59,511,106 (GRCm39) V349A probably benign Het
Chd9 A G 8: 91,683,044 (GRCm39) T495A probably benign Het
Cxxc1 G A 18: 74,353,630 (GRCm39) C546Y probably damaging Het
Cxxc5 T C 18: 35,992,268 (GRCm39) V223A probably damaging Het
Dlc1 A G 8: 37,404,841 (GRCm39) F316S probably benign Het
Dnajc12 C A 10: 63,233,104 (GRCm39) Q82K probably benign Het
Dock8 G A 19: 25,165,746 (GRCm39) E1877K probably damaging Het
Epha3 T G 16: 63,418,612 (GRCm39) H611P probably damaging Het
Fpr-rs6 C A 17: 20,402,701 (GRCm39) C220F probably damaging Het
Fryl A G 5: 73,179,554 (GRCm39) L2951P probably damaging Het
Gbp10 T G 5: 105,368,898 (GRCm39) T314P probably damaging Het
Hbb-bs T C 7: 103,476,741 (GRCm39) N77D probably benign Het
Ints13 A T 6: 146,456,531 (GRCm39) D438E probably damaging Het
Itgb6 C T 2: 60,480,365 (GRCm39) V324M probably benign Het
Kdm7a G T 6: 39,121,373 (GRCm39) L861M possibly damaging Het
Kirrel3 A G 9: 34,924,697 (GRCm39) T302A possibly damaging Het
Lama2 A T 10: 26,907,192 (GRCm39) probably null Het
Lrp2 A T 2: 69,302,709 (GRCm39) C3007S probably damaging Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Mastl T C 2: 23,045,988 (GRCm39) probably benign Het
Mcf2l T C 8: 13,068,919 (GRCm39) V1087A probably benign Het
Mcmdc2 C A 1: 10,001,003 (GRCm39) probably null Het
Ms4a3 A G 19: 11,615,659 (GRCm39) I39T probably damaging Het
Mylk T G 16: 34,700,643 (GRCm39) C495G probably benign Het
Myo10 A G 15: 25,804,469 (GRCm39) D1588G probably damaging Het
Myo15a A T 11: 60,396,832 (GRCm39) T2634S probably damaging Het
Nlrp1b T C 11: 71,108,122 (GRCm39) I460V probably benign Het
Nmt1 T G 11: 102,949,080 (GRCm39) S312A possibly damaging Het
Nynrin T G 14: 56,101,335 (GRCm39) S335A probably benign Het
Or2d4 T C 7: 106,543,839 (GRCm39) Y123C possibly damaging Het
Paxip1 T C 5: 27,996,222 (GRCm39) Y19C possibly damaging Het
Pcdhb2 G T 18: 37,429,577 (GRCm39) A517S probably damaging Het
Plec G A 15: 76,070,081 (GRCm39) Q806* probably null Het
Prss51 C T 14: 64,333,601 (GRCm39) A70V probably benign Het
Psd3 A T 8: 68,416,829 (GRCm39) I356K probably benign Het
Ptprn2 A T 12: 116,852,508 (GRCm39) I522F probably benign Het
Rab39 T C 9: 53,617,369 (GRCm39) D16G probably damaging Het
Ralgps1 T C 2: 33,033,112 (GRCm39) Q439R probably benign Het
Rapgef2 A T 3: 79,011,370 (GRCm39) D238E probably benign Het
Ripor2 G A 13: 24,890,215 (GRCm39) G697S probably damaging Het
Scn11a A T 9: 119,621,492 (GRCm39) F642I probably damaging Het
Serinc4 G A 2: 121,284,086 (GRCm39) T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Slc36a3 T C 11: 55,040,712 (GRCm39) probably benign Het
Smc1b A G 15: 84,991,211 (GRCm39) S656P probably damaging Het
Sorbs1 A G 19: 40,340,776 (GRCm39) S455P probably damaging Het
Ttn C A 2: 76,720,202 (GRCm39) probably benign Het
Tyw5 T C 1: 57,440,682 (GRCm39) R27G probably damaging Het
Vmn1r209 T C 13: 22,990,400 (GRCm39) T97A possibly damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44,146,075 (GRCm39) critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44,144,044 (GRCm39) missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44,180,718 (GRCm39) utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44,180,635 (GRCm39) missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44,142,662 (GRCm39) missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44,179,881 (GRCm39) missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44,145,707 (GRCm39) missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44,143,975 (GRCm39) missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44,146,070 (GRCm39) splice site probably null
R0762:Pkd2l1 UTSW 19 44,138,909 (GRCm39) missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44,142,861 (GRCm39) critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44,179,983 (GRCm39) splice site probably benign
R1381:Pkd2l1 UTSW 19 44,138,902 (GRCm39) missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44,142,648 (GRCm39) missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44,142,648 (GRCm39) missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44,144,040 (GRCm39) nonsense probably null
R2009:Pkd2l1 UTSW 19 44,144,403 (GRCm39) missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44,142,939 (GRCm39) missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44,145,708 (GRCm39) missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44,143,996 (GRCm39) missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44,143,996 (GRCm39) missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44,145,666 (GRCm39) missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44,180,620 (GRCm39) missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44,180,620 (GRCm39) missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44,142,573 (GRCm39) missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44,142,573 (GRCm39) missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44,142,573 (GRCm39) missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44,142,573 (GRCm39) missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44,144,060 (GRCm39) missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44,142,210 (GRCm39) missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44,142,581 (GRCm39) missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44,138,016 (GRCm39) missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44,146,171 (GRCm39) missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44,180,595 (GRCm39) missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44,140,529 (GRCm39) missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44,146,108 (GRCm39) missense probably benign 0.00
R6925:Pkd2l1 UTSW 19 44,179,947 (GRCm39) missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44,142,647 (GRCm39) missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44,146,129 (GRCm39) missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44,142,154 (GRCm39) missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44,145,668 (GRCm39) missense probably benign 0.01
R7636:Pkd2l1 UTSW 19 44,179,870 (GRCm39) missense possibly damaging 0.70
R7954:Pkd2l1 UTSW 19 44,142,651 (GRCm39) missense probably benign 0.15
R7989:Pkd2l1 UTSW 19 44,142,507 (GRCm39) missense probably benign 0.10
R9007:Pkd2l1 UTSW 19 44,140,864 (GRCm39) missense possibly damaging 0.49
R9245:Pkd2l1 UTSW 19 44,143,894 (GRCm39) missense probably benign 0.33
R9675:Pkd2l1 UTSW 19 44,137,696 (GRCm39) missense probably benign 0.00
X0026:Pkd2l1 UTSW 19 44,145,621 (GRCm39) missense probably damaging 1.00
Z1176:Pkd2l1 UTSW 19 44,137,710 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCATTCAAGAGCACAGGC -3'
(R):5'- AAGAGGCTCAGTGCTTTTAGTG -3'

Sequencing Primer
(F):5'- GGCGCCTGCACCAATCAAG -3'
(R):5'- TTTGGAGGTAAAAACCTAGGTCAC -3'
Posted On 2018-11-06