Incidental Mutation 'R6908:Ccdc186'
ID 538900
Institutional Source Beutler Lab
Gene Symbol Ccdc186
Ensembl Gene ENSMUSG00000035173
Gene Name coiled-coil domain containing 186
Synonyms Otg1, A630007B06Rik, 1810028B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6908 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 56787481-56822190 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 56791939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000076085] [ENSMUST00000118592]
AlphaFold Q8C9S4
Predicted Effect probably null
Transcript: ENSMUST00000076085
SMART Domains Protein: ENSMUSP00000075454
Gene: ENSMUSG00000035173

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118592
SMART Domains Protein: ENSMUSP00000113457
Gene: ENSMUSG00000035173

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135666
SMART Domains Protein: ENSMUSP00000122539
Gene: ENSMUSG00000035173

DomainStartEndE-ValueType
Blast:SPEC 2 75 2e-15 BLAST
coiled coil region 149 188 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Serinc4 G A 2: 121,453,605 T310I probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Ccdc186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Ccdc186 APN 19 56813447 missense probably benign 0.18
IGL00976:Ccdc186 APN 19 56797500 missense probably damaging 1.00
IGL01146:Ccdc186 APN 19 56809317 missense probably damaging 1.00
IGL01316:Ccdc186 APN 19 56813413 missense probably benign 0.01
IGL01627:Ccdc186 APN 19 56792020 missense probably damaging 1.00
IGL02325:Ccdc186 APN 19 56813356 missense probably benign 0.03
IGL02755:Ccdc186 APN 19 56813396 missense probably benign 0.06
IGL02899:Ccdc186 APN 19 56793488 missense probably benign 0.00
IGL03408:Ccdc186 APN 19 56798731 missense probably benign 0.00
receding UTSW 19 56800129 missense probably damaging 1.00
R1256:Ccdc186 UTSW 19 56797621 missense probably benign 0.20
R1728:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1729:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1784:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1813:Ccdc186 UTSW 19 56800169 missense probably benign 0.03
R1909:Ccdc186 UTSW 19 56793361 missense probably damaging 1.00
R2110:Ccdc186 UTSW 19 56800142 missense possibly damaging 0.80
R2319:Ccdc186 UTSW 19 56797567 missense possibly damaging 0.50
R2351:Ccdc186 UTSW 19 56798697 missense possibly damaging 0.89
R2970:Ccdc186 UTSW 19 56806998 missense probably damaging 1.00
R4159:Ccdc186 UTSW 19 56793492 nonsense probably null
R4898:Ccdc186 UTSW 19 56802000 splice site probably null
R4910:Ccdc186 UTSW 19 56798691 missense probably damaging 0.98
R5325:Ccdc186 UTSW 19 56813181 missense probably damaging 0.99
R5338:Ccdc186 UTSW 19 56813257 missense possibly damaging 0.87
R5662:Ccdc186 UTSW 19 56793488 missense probably benign
R5773:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6621:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6806:Ccdc186 UTSW 19 56800129 missense probably damaging 1.00
R6977:Ccdc186 UTSW 19 56798787 missense probably benign 0.05
R7108:Ccdc186 UTSW 19 56798760 missense probably damaging 1.00
R7190:Ccdc186 UTSW 19 56792000 missense probably damaging 1.00
R7407:Ccdc186 UTSW 19 56813385 missense probably benign 0.00
R7408:Ccdc186 UTSW 19 56808178 missense probably damaging 1.00
R7437:Ccdc186 UTSW 19 56806997 missense probably damaging 1.00
R8219:Ccdc186 UTSW 19 56793345 missense probably benign 0.42
R8422:Ccdc186 UTSW 19 56813185 missense probably benign 0.26
R8537:Ccdc186 UTSW 19 56810245 missense probably damaging 1.00
R8777:Ccdc186 UTSW 19 56813361 missense probably damaging 0.98
R8777-TAIL:Ccdc186 UTSW 19 56813361 missense probably damaging 0.98
R9510:Ccdc186 UTSW 19 56813584 missense probably benign 0.00
RF014:Ccdc186 UTSW 19 56813472 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTACCAAGACACCCTGTACTAG -3'
(R):5'- AGGCACACTTTCCTCAGAAGC -3'

Sequencing Primer
(F):5'- GGTTAAGAGAACTGACTGCTCTTCC -3'
(R):5'- GAAGCATCTGATTTTAACAAAGTGC -3'
Posted On 2018-11-06