Incidental Mutation 'R6909:Atic'
ID538902
Institutional Source Beutler Lab
Gene Symbol Atic
Ensembl Gene ENSMUSG00000026192
Gene Name5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms2610509C24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_026195; MGI: 1351352

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location71557150-71579631 bp(+) (GRCm38)
Type of Mutationsplice site (47 bp from exon)
DNA Base Change (assembly) T to G at 71576846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027384]
Predicted Effect probably null
Transcript: ENSMUST00000027384
SMART Domains Protein: ENSMUSP00000027384
Gene: ENSMUSG00000026192

DomainStartEndE-ValueType
MGS 16 130 1.31e-46 SMART
AICARFT_IMPCHas 135 462 4.84e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Atic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Atic APN 1 71570837 splice site probably benign
IGL02368:Atic APN 1 71564565 splice site probably benign
IGL03291:Atic APN 1 71570922 missense probably benign 0.06
3-1:Atic UTSW 1 71560895 nonsense probably null
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0558:Atic UTSW 1 71563788 missense probably benign 0.00
R1222:Atic UTSW 1 71559279 missense probably damaging 1.00
R1662:Atic UTSW 1 71576127 missense probably benign 0.06
R2075:Atic UTSW 1 71576127 missense probably benign 0.06
R2402:Atic UTSW 1 71569057 nonsense probably null
R2475:Atic UTSW 1 71559269 missense probably damaging 1.00
R2566:Atic UTSW 1 71568971 missense probably damaging 0.98
R3711:Atic UTSW 1 71578579 missense probably benign 0.02
R5115:Atic UTSW 1 71557275 critical splice donor site probably null
R5215:Atic UTSW 1 71564507 missense probably damaging 0.98
R5444:Atic UTSW 1 71576717 missense probably damaging 0.96
R6348:Atic UTSW 1 71576698 missense probably damaging 1.00
R6370:Atic UTSW 1 71578660 missense probably damaging 1.00
R6374:Atic UTSW 1 71564941 missense probably damaging 1.00
R7224:Atic UTSW 1 71570855 missense probably benign
R7444:Atic UTSW 1 71563787 missense probably benign 0.05
R7724:Atic UTSW 1 71564901 missense probably damaging 1.00
R8171:Atic UTSW 1 71569873 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CAGGTGATAAGGCAAACTCTTG -3'
(R):5'- ATGGAGAAGAACAGCCCTGC -3'

Sequencing Primer
(F):5'- ATAAGGCAAACTCTTGGTGGCTTC -3'
(R):5'- GCCCTGCAGTGACAATATTATAAC -3'
Posted On2018-11-06