Incidental Mutation 'R6909:Eps8l1'
ID538922
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4469900 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 107 (L107*)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably null
Transcript: ENSMUST00000086372
AA Change: L46*
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: L46*

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163137
AA Change: L46*
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154
AA Change: L46*

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably null
Transcript: ENSMUST00000163893
AA Change: L46*
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: L46*

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect probably null
Transcript: ENSMUST00000167810
AA Change: L46*
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154
AA Change: L46*

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169820
AA Change: L46*
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154
AA Change: L46*

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170635
AA Change: L46*
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154
AA Change: L46*

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect probably null
Transcript: ENSMUST00000171445
AA Change: L107*
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: L107*

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
R7539:Eps8l1 UTSW 7 4470037 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATCTAATCAGTGCTGGCCAC -3'
(R):5'- GATTCACCCTCAGATCTCAGC -3'

Sequencing Primer
(F):5'- TGGCCACTGAAGGAGCTG -3'
(R):5'- CTCAGATCTCAGCCCCATTTC -3'
Posted On2018-11-06