Incidental Mutation 'R6909:Gucy2d'
ID538923
Institutional Source Beutler Lab
Gene Symbol Gucy2d
Ensembl Gene ENSMUSG00000074003
Gene Nameguanylate cyclase 2d
Synonymsguanylyl cyclase D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location98440416-98477479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98467625 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 881 (Y881N)
Ref Sequence ENSEMBL: ENSMUSP00000095875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098274] [ENSMUST00000205350] [ENSMUST00000206435]
Predicted Effect probably damaging
Transcript: ENSMUST00000098274
AA Change: Y881N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095875
Gene: ENSMUSG00000074003
AA Change: Y881N

DomainStartEndE-ValueType
low complexity region 39 65 N/A INTRINSIC
Pfam:ANF_receptor 88 421 6.7e-49 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Pfam:Pkinase_Tyr 562 811 1.4e-33 PFAM
Pfam:Pkinase 575 811 1.3e-28 PFAM
CYCc 850 1045 8.67e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205350
Predicted Effect probably damaging
Transcript: ENSMUST00000206435
AA Change: Y882N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozugous for a null allele lack olfactory response to uroguanylin and guanylin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Gucy2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Gucy2d APN 7 98449963 missense probably benign 0.03
IGL02093:Gucy2d APN 7 98443548 nonsense probably null
IGL02839:Gucy2d APN 7 98443989 missense possibly damaging 0.81
IGL02904:Gucy2d APN 7 98462189 splice site probably null
IGL03253:Gucy2d APN 7 98451664 missense probably benign 0.03
IGL03349:Gucy2d APN 7 98449841 missense possibly damaging 0.75
R0025:Gucy2d UTSW 7 98467752 missense probably benign
R0362:Gucy2d UTSW 7 98443685 missense probably damaging 1.00
R0379:Gucy2d UTSW 7 98459002 splice site probably null
R0381:Gucy2d UTSW 7 98459002 splice site probably null
R0507:Gucy2d UTSW 7 98459002 splice site probably null
R0890:Gucy2d UTSW 7 98473265 missense probably benign 0.43
R1720:Gucy2d UTSW 7 98477230 missense probably benign 0.28
R1721:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1867:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1868:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1884:Gucy2d UTSW 7 98451608 missense probably benign 0.00
R1913:Gucy2d UTSW 7 98443847 missense probably benign 0.14
R2351:Gucy2d UTSW 7 98464019 missense probably benign 0.02
R4683:Gucy2d UTSW 7 98453443 missense probably benign 0.33
R5079:Gucy2d UTSW 7 98458268 critical splice acceptor site probably null
R5285:Gucy2d UTSW 7 98458267 splice site probably null
R5433:Gucy2d UTSW 7 98449775 missense probably damaging 1.00
R5859:Gucy2d UTSW 7 98451883 missense probably benign
R6148:Gucy2d UTSW 7 98443823 missense probably benign
R6468:Gucy2d UTSW 7 98449961 missense probably benign 0.00
R7400:Gucy2d UTSW 7 98443640 missense possibly damaging 0.95
R7483:Gucy2d UTSW 7 98449757 missense probably damaging 1.00
R7707:Gucy2d UTSW 7 98451669 missense possibly damaging 0.75
R7903:Gucy2d UTSW 7 98459065 missense probably damaging 1.00
R8277:Gucy2d UTSW 7 98443475 missense probably benign
R8412:Gucy2d UTSW 7 98443839 missense possibly damaging 0.84
RF030:Gucy2d UTSW 7 98459034 small insertion probably benign
RF055:Gucy2d UTSW 7 98459041 small insertion probably benign
RF064:Gucy2d UTSW 7 98459043 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TATCTGAGTTGAGCTCCTACTGCC -3'
(R):5'- AGGTCACCTGTTGTCCTCAC -3'

Sequencing Primer
(F):5'- CCAAGAGCAAGGAGTGGCTTTAATTC -3'
(R):5'- ACCTTATACACATCATGGCTGTCGAG -3'
Posted On2018-11-06