Incidental Mutation 'R6909:Ifitm5'
ID538924
Institutional Source Beutler Lab
Gene Symbol Ifitm5
Ensembl Gene ENSMUSG00000025489
Gene Nameinterferon induced transmembrane protein 5
SynonymsHrmp1, Bril, 1110003J06Rik, fragilis4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140948958-140950291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140949259 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 146 (F146L)
Ref Sequence ENSEMBL: ENSMUSP00000148225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably benign
Transcript: ENSMUST00000026562
AA Change: F128L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489
AA Change: F128L

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079403
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect probably benign
Transcript: ENSMUST00000164580
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211129
AA Change: F146L

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein thought to play a role in bone mineralization. This gene is located on chromosome 11 in a cluster of related genes which are induced by interferon, however, this gene has not been shown to be interferon inducible. A similar gene, located in a gene cluster on mouse chromosome 7, is a member of the interferon-inducible fragilis gene family. The mouse gene encodes a transmembrane protein described as participating in germ cell competence. A mutation in the 5' UTR of this gene has been associated with osteogenesis imperfecta type V (PMID: 22863190, 22863195). [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice exhbit smaller skeletons, partial prenatal and postnatal lethality, and small litter sizes. Mice that survive to adulthood still exhibit shorter bones but other skeletal defects are no longer seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Ifitm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ifitm5 APN 7 140950163 missense probably benign 0.43
R0265:Ifitm5 UTSW 7 140950008 intron probably benign
R4199:Ifitm5 UTSW 7 140949236 makesense probably null
R4793:Ifitm5 UTSW 7 140950164 missense probably benign 0.01
R5031:Ifitm5 UTSW 7 140950104 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAGCATCAAATACACATCGTG -3'
(R):5'- AACATCTTGTTTCTGGTGCTGC -3'

Sequencing Primer
(F):5'- TCAAATACACATCGTGGACAAGAG -3'
(R):5'- CAGGCCCGAGACCAGAAG -3'
Posted On2018-11-06