Incidental Mutation 'R6909:Tk2'
ID538928
Institutional Source Beutler Lab
Gene Symbol Tk2
Ensembl Gene ENSMUSG00000035824
Gene Namethymidine kinase 2, mitochondrial
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104226685-104248558 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 104236810 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 142 (Y142*)
Ref Sequence ENSEMBL: ENSMUSP00000148642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050211] [ENSMUST00000211995] [ENSMUST00000212209] [ENSMUST00000212275] [ENSMUST00000212854]
Predicted Effect probably null
Transcript: ENSMUST00000050211
AA Change: Y142*
SMART Domains Protein: ENSMUSP00000053616
Gene: ENSMUSG00000035824
AA Change: Y142*

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
Pfam:dNK 58 267 1.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211995
Predicted Effect probably benign
Transcript: ENSMUST00000212209
Predicted Effect probably null
Transcript: ENSMUST00000212275
AA Change: Y142*
Predicted Effect probably benign
Transcript: ENSMUST00000212854
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonucleoside kinase that specifically phosphorylates thymidine, deoxycytidine, and deoxyuridine. The encoded enzyme localizes to the mitochondria and is required for mitochondrial DNA synthesis. Mutations in this gene are associated with a myopathic form of mitochondrial DNA depletion syndrome. Alternate splicing results in multiple transcript variants encoding distinct isoforms, some of which lack transit peptide, so are not localized to mitochondria. [provided by RefSeq, Dec 2012]
PHENOTYPE: Knock-out mice die at 2-4 wks of age showing stunted growth, hypothermia, progressive mtDNA loss, aberrant myocardial fibers and altered adipose tissue structure. Knock-in mutant mice show encephalomyelopathy, impaired gait, mtDNA loss, altered mt dNTP pools and respiratory chain enzyme activities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Tk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Tk2 APN 8 104241138 missense probably damaging 1.00
IGL02525:Tk2 APN 8 104243400 missense probably benign 0.02
IGL03211:Tk2 APN 8 104243441 missense probably damaging 1.00
R0333:Tk2 UTSW 8 104248514 unclassified probably benign
R0691:Tk2 UTSW 8 104231192 missense probably benign 0.16
R1851:Tk2 UTSW 8 104248445 nonsense probably null
R3508:Tk2 UTSW 8 104231193 missense probably benign 0.00
R3605:Tk2 UTSW 8 104231171 missense possibly damaging 0.95
R4161:Tk2 UTSW 8 104238833 missense probably benign 0.00
R5328:Tk2 UTSW 8 104229299 splice site probably null
R5546:Tk2 UTSW 8 104247683 missense possibly damaging 0.51
R8098:Tk2 UTSW 8 104231172 missense probably benign 0.05
R8354:Tk2 UTSW 8 104241114 critical splice donor site probably null
R8357:Tk2 UTSW 8 104236818 missense probably damaging 1.00
R8454:Tk2 UTSW 8 104241114 critical splice donor site probably null
R8457:Tk2 UTSW 8 104236818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACGCACCCACACCTATG -3'
(R):5'- ACACAGTGAGTCTCATGGCA -3'

Sequencing Primer
(F):5'- GCACCCACACCTATGCACTC -3'
(R):5'- CACAGTGAGTCTCATGGCAGATTTG -3'
Posted On2018-11-06