Incidental Mutation 'R6909:Acpp'
ID538931
Institutional Source Beutler Lab
Gene Symbol Acpp
Ensembl Gene ENSMUSG00000032561
Gene Nameacid phosphatase, prostate
SynonymsA030005E02Rik, PAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location104288251-104337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104300965 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 329 (Y329C)
Ref Sequence ENSEMBL: ENSMUSP00000108209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062723] [ENSMUST00000112590]
Predicted Effect probably damaging
Transcript: ENSMUST00000062723
AA Change: Y329C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059889
Gene: ENSMUSG00000032561
AA Change: Y329C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 3.8e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112590
AA Change: Y329C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108209
Gene: ENSMUSG00000032561
AA Change: Y329C

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 1.8e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thermal nociceptive threshold and mechanical allodynia in chronic inflammatory and nerve injury pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Acpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Acpp APN 9 104326948 missense probably damaging 1.00
IGL02994:Acpp APN 9 104309403 splice site probably benign
IGL03069:Acpp APN 9 104320005 missense possibly damaging 0.78
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0084:Acpp UTSW 9 104314365 missense probably benign 0.07
R0098:Acpp UTSW 9 104319945 splice site probably null
R0119:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0299:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0362:Acpp UTSW 9 104314427 missense probably damaging 1.00
R0499:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0514:Acpp UTSW 9 104319978 missense probably damaging 1.00
R0964:Acpp UTSW 9 104326975 missense possibly damaging 0.94
R1506:Acpp UTSW 9 104324174 missense probably damaging 1.00
R1624:Acpp UTSW 9 104320001 missense probably benign 0.39
R2019:Acpp UTSW 9 104324702 missense probably damaging 1.00
R3821:Acpp UTSW 9 104324717 missense probably damaging 0.99
R3822:Acpp UTSW 9 104324717 missense probably damaging 0.99
R4896:Acpp UTSW 9 104306975 missense probably damaging 1.00
R5084:Acpp UTSW 9 104326917 missense probably damaging 1.00
R5257:Acpp UTSW 9 104309475 missense probably benign 0.24
R5258:Acpp UTSW 9 104309475 missense probably benign 0.24
R5519:Acpp UTSW 9 104291488 missense probably damaging 1.00
R5795:Acpp UTSW 9 104309489 missense probably benign 0.04
R7315:Acpp UTSW 9 104316224 critical splice donor site probably null
R7349:Acpp UTSW 9 104291458 missense probably benign 0.01
R7792:Acpp UTSW 9 104326966 missense probably damaging 1.00
R8355:Acpp UTSW 9 104326975 missense possibly damaging 0.94
R8455:Acpp UTSW 9 104326975 missense possibly damaging 0.94
Z1177:Acpp UTSW 9 104314418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGGAAGCCCTAGTTGC -3'
(R):5'- ATGAGTCAGCCCTCCCAATTC -3'

Sequencing Primer
(F):5'- AAGCCCTAGTTGCTTGAGC -3'
(R):5'- CAAGCCTGTTGCCCCTG -3'
Posted On2018-11-06