Incidental Mutation 'R6909:Sim1'
ID538933
Institutional Source Beutler Lab
Gene Symbol Sim1
Ensembl Gene ENSMUSG00000019913
Gene Namesingle-minded family bHLH transcription factor 1
SynonymsbHLHe14
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location50894754-50989152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50909410 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 192 (R192C)
Ref Sequence ENSEMBL: ENSMUSP00000020071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020071
AA Change: R192C

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: R192C

DomainStartEndE-ValueType
HLH 6 59 8.73e-6 SMART
PAS 79 145 7.39e-14 SMART
PAS 220 286 5.61e-5 SMART
PAC 292 335 4.63e-6 SMART
Pfam:SIM_C 359 668 2.5e-114 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Sim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Sim1 APN 10 50981534 missense probably damaging 0.99
IGL01142:Sim1 APN 10 50910671 missense probably damaging 0.99
IGL01886:Sim1 APN 10 50984315 missense probably damaging 1.00
PIT4585001:Sim1 UTSW 10 50984188 nonsense probably null
R0128:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0130:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0717:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R0948:Sim1 UTSW 10 50981327 nonsense probably null
R1169:Sim1 UTSW 10 50981522 missense probably benign 0.13
R1388:Sim1 UTSW 10 50895994 missense probably damaging 1.00
R1746:Sim1 UTSW 10 50984109 missense probably benign
R1778:Sim1 UTSW 10 50981553 nonsense probably null
R1834:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R2434:Sim1 UTSW 10 50907958 missense probably damaging 1.00
R2919:Sim1 UTSW 10 50909815 missense probably benign 0.23
R3617:Sim1 UTSW 10 50909528 missense probably damaging 1.00
R3625:Sim1 UTSW 10 50981336 missense probably benign 0.30
R4152:Sim1 UTSW 10 50983854 missense probably damaging 0.98
R4414:Sim1 UTSW 10 50981612 missense probably benign 0.13
R4645:Sim1 UTSW 10 50983997 missense probably benign 0.13
R4781:Sim1 UTSW 10 50983785 missense probably benign 0.08
R4889:Sim1 UTSW 10 50981324 missense probably benign 0.05
R4924:Sim1 UTSW 10 50909902 missense probably damaging 1.00
R6625:Sim1 UTSW 10 50983986 missense probably benign
R6783:Sim1 UTSW 10 50908727 missense possibly damaging 0.72
R6876:Sim1 UTSW 10 50983695 missense possibly damaging 0.77
R6924:Sim1 UTSW 10 50908539 missense probably benign 0.10
R7016:Sim1 UTSW 10 50984250 missense probably benign 0.03
R7135:Sim1 UTSW 10 50895927 missense probably damaging 0.99
R7149:Sim1 UTSW 10 50909540 missense probably damaging 1.00
R7300:Sim1 UTSW 10 50909518 missense probably benign 0.23
R7750:Sim1 UTSW 10 50896035 missense possibly damaging 0.94
R7973:Sim1 UTSW 10 50981323 missense probably damaging 1.00
R8087:Sim1 UTSW 10 50909555 missense possibly damaging 0.95
Z1177:Sim1 UTSW 10 50984328 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATGACTTCCCCATGGCTGTG -3'
(R):5'- GTTTAGTGCTGCAACTGTTCAG -3'

Sequencing Primer
(F):5'- TCCCCATGGCTGTGCAGTC -3'
(R):5'- GCAACTGTTCAGAGTCTCCG -3'
Posted On2018-11-06