Incidental Mutation 'R6909:Scyl2'
ID538934
Institutional Source Beutler Lab
Gene Symbol Scyl2
Ensembl Gene ENSMUSG00000069539
Gene NameSCY1-like 2 (S. cerevisiae)
SynonymsCVAK104, D10Ertd802e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location89638721-89686285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89645742 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 622 (S622T)
Ref Sequence ENSEMBL: ENSMUSP00000133992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]
Predicted Effect probably benign
Transcript: ENSMUST00000092227
AA Change: S622T

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: S622T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 9.7e-15 PFAM
Pfam:Pkinase 32 327 4.6e-24 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 679 704 N/A INTRINSIC
low complexity region 896 921 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174252
AA Change: S622T

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: S622T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 6.4e-15 PFAM
Pfam:Pkinase 32 327 2.9e-26 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 897 922 N/A INTRINSIC
Meta Mutation Damage Score 0.0994 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,115,497 Q1261K probably benign Het
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Scyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Scyl2 APN 10 89657809 critical splice donor site probably null
IGL01141:Scyl2 APN 10 89640635 missense probably benign
IGL01597:Scyl2 APN 10 89652987 missense probably damaging 0.99
IGL01713:Scyl2 APN 10 89654225 missense probably damaging 1.00
IGL02349:Scyl2 APN 10 89657938 splice site probably benign
IGL02466:Scyl2 APN 10 89653009 nonsense probably null
IGL02511:Scyl2 APN 10 89640819 missense probably benign
IGL02949:Scyl2 APN 10 89660301 missense possibly damaging 0.82
IGL03087:Scyl2 APN 10 89652968 missense possibly damaging 0.93
IGL03117:Scyl2 APN 10 89657867 missense possibly damaging 0.95
IGL03228:Scyl2 APN 10 89650080 missense probably damaging 1.00
R0019:Scyl2 UTSW 10 89659321 missense probably benign 0.44
R0827:Scyl2 UTSW 10 89657865 missense possibly damaging 0.91
R1394:Scyl2 UTSW 10 89640965 missense possibly damaging 0.59
R1460:Scyl2 UTSW 10 89657889 missense possibly damaging 0.90
R1572:Scyl2 UTSW 10 89650956 missense probably damaging 1.00
R1624:Scyl2 UTSW 10 89640736 missense probably benign 0.19
R1909:Scyl2 UTSW 10 89640905 missense probably benign 0.01
R3846:Scyl2 UTSW 10 89640541 missense probably damaging 1.00
R4041:Scyl2 UTSW 10 89650052 missense probably damaging 1.00
R4077:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4079:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4765:Scyl2 UTSW 10 89659298 missense probably damaging 0.97
R4855:Scyl2 UTSW 10 89640463 utr 3 prime probably benign
R5308:Scyl2 UTSW 10 89642007 missense probably benign 0.01
R5894:Scyl2 UTSW 10 89640819 missense probably benign
R5901:Scyl2 UTSW 10 89660262 missense probably benign 0.03
R6048:Scyl2 UTSW 10 89645486 missense probably benign 0.33
R6249:Scyl2 UTSW 10 89657857 missense possibly damaging 0.93
R6658:Scyl2 UTSW 10 89640973 missense probably benign 0.01
R6827:Scyl2 UTSW 10 89669804 critical splice acceptor site probably null
R7027:Scyl2 UTSW 10 89645461 critical splice donor site probably null
R7095:Scyl2 UTSW 10 89669687 missense probably damaging 1.00
R8062:Scyl2 UTSW 10 89654160 missense probably damaging 0.97
R8095:Scyl2 UTSW 10 89641103 missense probably damaging 1.00
R8197:Scyl2 UTSW 10 89662366 missense probably benign 0.33
R8232:Scyl2 UTSW 10 89662447 missense probably damaging 1.00
R8241:Scyl2 UTSW 10 89654109 missense possibly damaging 0.80
R8263:Scyl2 UTSW 10 89640663 missense possibly damaging 0.50
Z1177:Scyl2 UTSW 10 89669715 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGCTCCAATGTTGTTAAAGACCTTATC -3'
(R):5'- GCCCAAAGGATAAACGTTGAATTG -3'

Sequencing Primer
(F):5'- ATCAATCTGCTGAAATACAAGTCC -3'
(R):5'- GGATTCAGGTCATCAGACTTTCACG -3'
Posted On2018-11-06